Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog TrpR - Pasteurellales

Properties
Regulator type: Transcription factor
Regulator family: TrpR
Regulation mode: repressor
Biological process: Tryptophan biosynthesis
Effector: Tryptophan
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 34 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Haemophilus influenzae Rd KW20 11 5
Aggregatibacter aphrophilus NJ8700 10 4
Pasteurella multocida subsp. multocida str. Pm70 8 5
Mannheimia succiniciproducens MBEL55E 6 5
Actinobacillus succinogenes 130Z 9 5
Haemophilus somnus 2336 9 4
Actinobacillus pleuropneumoniae serovar 7 str. AP76 6 3
Haemophilus ducreyi 35000HP
Haemophilus parasuis SH0165 9 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
HAPS_0395
 
Haemophilus influenzae Rd KW20
 
Aggregatibacter aphrophilus NJ8700
 
Pasteurella multocida subsp. multocida str. Pm70
 
Mannheimia succiniciproducens MBEL55E
 
Actinobacillus succinogenes 130Z
 
Haemophilus somnus 2336
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Haemophilus ducreyi 35000HP
*
Haemophilus parasuis SH0165

Site:
position = -52
score = 6.58143
sequence = TGTACTATTTTAATAGTACA

Gene: HAPS_0395: ABC transporter, substrate binding component
ABC transporter, substrate binding component
 
CRON 2.
aroG
*
Haemophilus influenzae Rd KW20

Site:
position = -81
score = 6.23662
sequence = CGAACTAGTTTACTAGTACA

Gene: HI1547: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
 
Aggregatibacter aphrophilus NJ8700
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -123
score = 5.89992
sequence = AAAACTAGTTTACTAGTGTA

Gene: PM0563: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -90
score = 5.89808
sequence = TGTACTAGTTTACCAATGCA

Gene: MS1184: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Actinobacillus succinogenes 130Z

Site:
position = -176
score = 6.65185
sequence = TGAACTAGTTTACTAGTGCA

Gene: Asuc_1428: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Haemophilus somnus 2336

Site:
position = -104
score = 5.58052
sequence = GAAATTAGTTTACTAGTACA

Gene: HSM_1416: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Site:
position = -106
score = 6.32082
sequence = TGTACTAGTAAAATAGTTCA

Gene: APP7_0666: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
 
Haemophilus ducreyi 35000HP

Gene: HD1475: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
 
Haemophilus parasuis SH0165

Gene: HAPS_0321: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
 
CRON 3.
trpR
*
Haemophilus influenzae Rd KW20

Site:
position = -36
score = 6.65185
sequence = TGCACTAGTTTAATAGTGTA

Gene: HI0830: trp operon repressor
*
Aggregatibacter aphrophilus NJ8700

Site:
position = -31
score = 6.23662
sequence = CGCACTAGTTTAATAGTATA

Gene: NT05HA_1280: trp operon repressor
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM0325: trp operon repressor
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -42
score = 6.16087
sequence = TATACTAGTTTAATAGTATG

Gene: MS1566: trp operon repressor
*
Actinobacillus succinogenes 130Z

Site:
position = -33
score = 6.65185
sequence = TGCACTAGTTTAATAGTGTA

Gene: Asuc_1556: trp operon repressor
*
Haemophilus somnus 2336

Site:
position = -29
score = 5.50754
sequence = TACACTAGTTTAATAGTCAG

Gene: HSM_1017: trp operon repressor
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_0553: trp operon repressor
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165

Gene: HAPS_0251: trp operon repressor
trp operon repressor
 
CRON 4.
mtr
*
Haemophilus influenzae Rd KW20

Site:
position = -41
score = 6.46254
sequence = TGTACTACTATAATAGTGCA

Gene: HI0287: Tryptophan-specific transport protein
*
Aggregatibacter aphrophilus NJ8700

Site:
position = -44
score = 6.19971
sequence = TGTACTATTATAATAGTCCA

Gene: NT05HA_1570: Tryptophan-specific transport protein
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -61
score = 6.08274
sequence = TGCACTATTAAAATAGTGCA

Gene: PM1192: Tryptophan-specific transport protein
*
Mannheimia succiniciproducens MBEL55E

Site:
position = 1
score = 6.34514
sequence = TGTACTACTATAATAGTTCA

Gene: MS1895: Tryptophan-specific transport protein
*
Actinobacillus succinogenes 130Z

Site:
position = -44
score = 6.37151
sequence = TGCACTACTATAATAGTGCA

Gene: Asuc_0628: Tryptophan-specific transport protein
*
Haemophilus somnus 2336

Site:
position = -49
score = 6.30536
sequence = TGAACTATTATAATAGTTCA

Gene: HSM_0462: Tryptophan-specific transport protein
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165
Tryptophan-specific transport protein
 
CRON 5.
trpE
*
Haemophilus influenzae Rd KW20

Site:
position = -45
score = 6.75485
sequence = TGCACTAGTTTAATAGTACA

Gene: HI1387: Anthranilate synthase, aminase component (EC 4.1.3.27)
*
Aggregatibacter aphrophilus NJ8700

Site:
position = -51
score = 6.9369
sequence = TGTACTAGTTTAATAGTGCA

Gene: NT05HA_0807: Anthranilate synthase, aminase component (EC 4.1.3.27)
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -51
score = 6.56981
sequence = TAAACTAGTTTAATAGTTCA

Gene: PM0584: Anthranilate synthase, aminase component (EC 4.1.3.27)
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -50
score = 6.9369
sequence = TGTACTAGTTTAATAGTGCA

Gene: MS1149: Anthranilate synthase, aminase component (EC 4.1.3.27)
*
Actinobacillus succinogenes 130Z

Site:
position = -46
score = 6.9369
sequence = TGTACTAGTTTAATAGTGCA

Gene: Asuc_1272: Anthranilate synthase, aminase component (EC 4.1.3.27)
*
Haemophilus somnus 2336

Site:
position = -52
score = 6.40428
sequence = CGCACTAGTTTAATAGTTCA

Gene: HSM_1315: Anthranilate synthase, aminase component (EC 4.1.3.27)
*
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Site:
position = -48
score = 6.3549
sequence = TATACTAGTTTAATAGTACG

Gene: APP7_1221: Anthranilate synthase, aminase component (EC 4.1.3.27)
 
Haemophilus ducreyi 35000HP
*
Haemophilus parasuis SH0165

Site:
position = -47
score = 6.6872
sequence = TATACTAGTTTAATAGTACA

Gene: HAPS_1997: Anthranilate synthase, aminase component (EC 4.1.3.27)
Anthranilate synthase, aminase component (EC 4.1.3.27)
trpG
 
Haemophilus influenzae Rd KW20

Gene: HI1388: Anthranilate synthase, amidotransferase component (EC 4.1.3.27)
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_0808: Anthranilate synthase, amidotransferase component (EC 4.1.3.27)
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM0583: Anthranilate synthase, amidotransferase component (EC 4.1.3.27)
 
Mannheimia succiniciproducens MBEL55E

Gene: MS1150: Anthranilate synthase, amidotransferase component (EC 4.1.3.27)
 
Actinobacillus succinogenes 130Z

Gene: Asuc_1271: Anthranilate synthase, amidotransferase component (EC 4.1.3.27)
 
Haemophilus somnus 2336

Gene: HSM_1314: Anthranilate synthase, amidotransferase component (EC 4.1.3.27)
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_1222: Anthranilate synthase, amidotransferase component (EC 4.1.3.27)
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165

Gene: HAPS_1996: Anthranilate synthase, amidotransferase component (EC 4.1.3.27)
Anthranilate synthase, amidotransferase component (EC 4.1.3.27)
trpD
 
Haemophilus influenzae Rd KW20

Gene: HI1389: Anthranilate phosphoribosyltransferase (EC 2.4.2.18)
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_0810: Anthranilate phosphoribosyltransferase (EC 2.4.2.18)
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -57
score = 6.21816
sequence = TGTACTAGTTTAATAGTTTT

Gene: PM0581: Anthranilate phosphoribosyltransferase (EC 2.4.2.18)
 
Mannheimia succiniciproducens MBEL55E

Gene: MS1151: Anthranilate phosphoribosyltransferase (EC 2.4.2.18)
 
Actinobacillus succinogenes 130Z

Gene: Asuc_1270: Anthranilate phosphoribosyltransferase (EC 2.4.2.18)
 
Haemophilus somnus 2336

Gene: HSM_1313: Anthranilate phosphoribosyltransferase (EC 2.4.2.18)
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_1223: Anthranilate phosphoribosyltransferase (EC 2.4.2.18)
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165

Gene: HAPS_1995: Anthranilate phosphoribosyltransferase (EC 2.4.2.18)
Anthranilate phosphoribosyltransferase (EC 2.4.2.18)
trpC
 
Haemophilus influenzae Rd KW20

Gene: HI1389.1: Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_0811: Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM0580: Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)
 
Mannheimia succiniciproducens MBEL55E

Gene: MS1152: Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)
 
Actinobacillus succinogenes 130Z

Gene: Asuc_1269: Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)
 
Haemophilus somnus 2336

Gene: HSM_1312: Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_0918: Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165

Gene: HAPS_1994: Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)
Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)
trpB
 
Haemophilus influenzae Rd KW20

Gene: HI1431: Tryptophan synthase beta chain (EC 4.2.1.20)
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_0825: Tryptophan synthase beta chain (EC 4.2.1.20)
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -93
score = 6.84587
sequence = TGAACTAGTTTAATAGTGCA

Gene: PM0578: Tryptophan synthase beta chain (EC 4.2.1.20)
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -52
score = 6.65185
sequence = TGTACTAGTTTAATAGTATA

Gene: MS1153: Tryptophan synthase beta chain (EC 4.2.1.20)
*
Actinobacillus succinogenes 130Z

Site:
position = -52
score = 5.78551
sequence = TGTACTAGTTAACTAGTATG

Gene: Asuc_1478: Tryptophan synthase beta chain (EC 4.2.1.20)
 
Haemophilus somnus 2336

Gene: HSM_1311: Tryptophan synthase beta chain (EC 4.2.1.20)
*
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Site:
position = -47
score = 6.67246
sequence = TGTACTATTTTAATAGTGCA

Gene: APP7_0546: Tryptophan synthase beta chain (EC 4.2.1.20)
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165

Gene: HAPS_1993: Tryptophan synthase beta chain (EC 4.2.1.20)
Tryptophan synthase beta chain (EC 4.2.1.20)
trpA
 
Haemophilus influenzae Rd KW20

Gene: HI1432: Tryptophan synthase alpha chain (EC 4.2.1.20)
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_0826: Tryptophan synthase alpha chain (EC 4.2.1.20)
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM0577: Tryptophan synthase alpha chain (EC 4.2.1.20)
 
Mannheimia succiniciproducens MBEL55E

Gene: MS1154: Tryptophan synthase alpha chain (EC 4.2.1.20)
 
Actinobacillus succinogenes 130Z

Gene: Asuc_1479: Tryptophan synthase alpha chain (EC 4.2.1.20)
 
Haemophilus somnus 2336

Gene: HSM_1310: Tryptophan synthase alpha chain (EC 4.2.1.20)
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_0547: Tryptophan synthase alpha chain (EC 4.2.1.20)
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165

Gene: HAPS_1992: Tryptophan synthase alpha chain (EC 4.2.1.20)
Tryptophan synthase alpha chain (EC 4.2.1.20)
HI1388.1
 
Haemophilus influenzae Rd KW20

Gene: HI1388.1: hypothetical protein
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_0809: hypothetical protein
 
Pasteurella multocida subsp. multocida str. Pm70
 
Mannheimia succiniciproducens MBEL55E
 
Actinobacillus succinogenes 130Z
 
Haemophilus somnus 2336
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165
hypothetical protein
COG4221
*
Haemophilus influenzae Rd KW20

Site:
position = -46
score = 6.53019
sequence = TGTACTACTTTAATAGTACA

Gene: HI1430: Short-chain alcohol dehydrogenase of unknown specificity
*
Aggregatibacter aphrophilus NJ8700

Site:
position = -102
score = 5.26195
sequence = TGTACTAGTGTAGTAGTATG

Gene: NT05HA_0824: Short-chain alcohol dehydrogenase of unknown specificity
 
Pasteurella multocida subsp. multocida str. Pm70
 
Mannheimia succiniciproducens MBEL55E

Gene: MS1568: Short-chain alcohol dehydrogenase of unknown specificity
 
Actinobacillus succinogenes 130Z

Gene: Asuc_0225: Short-chain alcohol dehydrogenase of unknown specificity
 
Haemophilus somnus 2336
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165
Short-chain alcohol dehydrogenase of unknown specificity
 
CRON 6.
HAPS_1139
 
Haemophilus influenzae Rd KW20
 
Aggregatibacter aphrophilus NJ8700
 
Pasteurella multocida subsp. multocida str. Pm70
 
Mannheimia succiniciproducens MBEL55E
 
Actinobacillus succinogenes 130Z
 
Haemophilus somnus 2336
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Haemophilus ducreyi 35000HP
*
Haemophilus parasuis SH0165

Site:
position = -26
score = 5.74584
sequence = TGTACTAGTAAAATAGTATT

Gene: HAPS_1139: ABC transporter, inner-membrane component
ABC transporter, inner-membrane component
HAPS_1138
 
Haemophilus influenzae Rd KW20
 
Aggregatibacter aphrophilus NJ8700
 
Pasteurella multocida subsp. multocida str. Pm70
 
Mannheimia succiniciproducens MBEL55E
 
Actinobacillus succinogenes 130Z
 
Haemophilus somnus 2336
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165

Gene: HAPS_1138: ABC transporter, ATP-binding protein
ABC transporter, ATP-binding protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD