Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Fur - Xanthomonadales

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 49 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Xylella fastidiosa 9a5c 10 5
Xanthomonas axonopodis pv. citri str. 306 19 11
Xanthomonas campestris pv. campestris str. ATCC 33913 20 11
Stenotrophomonas maltophilia K279a 39 17
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
bfd
*
Xylella fastidiosa 9a5c

Site:
position = -64
score = 5.36465
sequence = AATTGACATTCATTCTCATCT

Gene: XF0394: Bacterioferritin-associated ferredoxin
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -73
score = 5.04459
sequence = AATTGACACCTATTCTCGTTT

Gene: XAC0492: Bacterioferritin-associated ferredoxin
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -73
score = 5.04459
sequence = AATTGACACCTATTCTCGTTT

Gene: XCC0481: Bacterioferritin-associated ferredoxin
*
Stenotrophomonas maltophilia K279a

Site:
position = -73
score = 5.38699
sequence = GATTGACAACCATTCTCGTTT

Gene: Smlt4298: Bacterioferritin-associated ferredoxin
Bacterioferritin-associated ferredoxin
bfr
*
Xylella fastidiosa 9a5c

Site:
position = -78
score = 4.88222
sequence = TAATGAGCACGATTTTCGTTC

Gene: XF0395: Bacterioferritin
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -80
score = 4.35493
sequence = AACTGATCACGATTCGCGTTC

Gene: XAC0493: Bacterioferritin
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -80
score = 4.35493
sequence = AACTGATCACGATTCGCGTTC

Gene: XCC0482: Bacterioferritin
*
Stenotrophomonas maltophilia K279a

Site:
position = -81
score = 4.24574
sequence = CAATGCGCACGATTCGCGTTC

Gene: Smlt4297: Bacterioferritin
Bacterioferritin
 
CRON 2.
fhuA
*
Xylella fastidiosa 9a5c

Site:
position = -112
score = 5.62784
sequence = TATTGAAAATCATTCTCCTTT

Gene: XF0599: Ferrichrome-iron receptor, TonB-dependent
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -252
score = 5.46553
sequence = AAAGAAGAATGATTTGCATTT

Gene: XAC2941: Ferrichrome-iron receptor, TonB-dependent
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -263
score = 5.46553
sequence = AAAGAAGAATGATTTGCATTT

Gene: XCC2772: Ferrichrome-iron receptor, TonB-dependent
 
Stenotrophomonas maltophilia K279a

Gene: Smlt1148: Ferrichrome-iron receptor, TonB-dependent
Ferrichrome-iron receptor, TonB-dependent
piuC
 
Xylella fastidiosa 9a5c

Gene: XF0598: Iron-uptake factor PiuC
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC2942: Iron-uptake factor PiuC
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC2773: Iron-uptake factor PiuC
 
Stenotrophomonas maltophilia K279a

Gene: Smlt1146: Iron-uptake factor PiuC
Iron-uptake factor PiuC
XAC2943
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC2943: FOG: TPR repeat, SEL1 subfamily
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC2774: FOG: TPR repeat, SEL1 subfamily
 
Stenotrophomonas maltophilia K279a

Gene: Smlt1147: FOG: TPR repeat, SEL1 subfamily
FOG: TPR repeat, SEL1 subfamily
pepSY
 
Xylella fastidiosa 9a5c

Gene: XF0597: putative transmembrane PepSY family protein
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC2944: putative transmembrane PepSY family protein
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC2775: putative transmembrane PepSY family protein
*
Stenotrophomonas maltophilia K279a

Site:
position = -85
score = 4.59134
sequence = AATTGCGAGCTATTCTCATCA

Gene: Smlt1142: putative transmembrane PepSY family protein
putative transmembrane PepSY family protein
COG3656
 
Xylella fastidiosa 9a5c

Gene: XF0596: Predicted periplasmic protein
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC2945: Predicted periplasmic protein
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC2776: Predicted periplasmic protein
 
Stenotrophomonas maltophilia K279a

Gene: Smlt1141: Predicted periplasmic protein
Predicted periplasmic protein
Smlt1149
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913
*
Stenotrophomonas maltophilia K279a

Site:
position = -66
score = 5.07384
sequence = ATATGCGAATCATTATCGTTG

Gene: Smlt1149: hypothetical protein
hypothetical protein
 
CRON 3.
hemP
 
Xylella fastidiosa 9a5c
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -2
score = 6.14308
sequence = AAATGAGAATGGTTATTATTT

Site:
position = -26
score = 4.88495
sequence = AAATGAGAATGGCTCTTGATC

Gene: XAC0822: Hemin uptake protein HemP
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -2
score = 6.14308
sequence = AAATGAGAATGGTTATTATTT

Site:
position = -26
score = 4.88495
sequence = AAATGAGAATGGCTCTTGATC

Gene: XCC0767: Hemin uptake protein HemP
*
Stenotrophomonas maltophilia K279a

Site:
position = -45
score = 6.12706
sequence = AACTGAGAATCATTATCATTT

Site:
position = -69
score = 5.13479
sequence = AATTGAGAATGGTTGTTGATT

Gene: Smlt0794: Hemin uptake protein HemP
Hemin uptake protein HemP
hemR
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC0823: Hemin uptake system outer membrane receptor, TonB-dependent
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC0768: Hemin uptake system outer membrane receptor, TonB-dependent
 
Stenotrophomonas maltophilia K279a

Gene: Smlt0795: Hemin uptake system outer membrane receptor, TonB-dependent
Hemin uptake system outer membrane receptor, TonB-dependent
XAC0824
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC0824: Hemin transport protein
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC0769: Hemin transport protein
 
Stenotrophomonas maltophilia K279a

Gene: Smlt0796: Hemin transport protein
Hemin transport protein
 
CRON 4.
fhuA
 
Xylella fastidiosa 9a5c
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -28
score = 5.23744
sequence = ATTTGATAACCATTCCCATTA

Gene: XAC1435: Outer membrane receptor proteins, mostly Fe transport, TonB-dependent
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -28
score = 5.23744
sequence = ATTTGATAACCATTCCCATTA

Gene: XCC1391: Outer membrane receptor proteins, mostly Fe transport, TonB-dependent
*
Stenotrophomonas maltophilia K279a

Site:
position = -42
score = 5.86012
sequence = AAATGCTAATCTTTCTCATTT

Gene: Smlt3022: Outer membrane receptor proteins, mostly Fe transport, TonB-dependent
Outer membrane receptor proteins, mostly Fe transport, TonB-dependent
 
CRON 5.
fpr
 
Xylella fastidiosa 9a5c

Gene: XF1889: Ferredoxin--NADP(+) reductase (EC 1.18.1.2)
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -71
score = 5.47226
sequence = AAATGAGAGTTCATCTCATTT

Gene: XAC1458: Ferredoxin--NADP(+) reductase (EC 1.18.1.2)
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -73
score = 5.47226
sequence = AAATGAGAGTTCATCTCATTT

Gene: XCC1414: Ferredoxin--NADP(+) reductase (EC 1.18.1.2)
*
Stenotrophomonas maltophilia K279a

Site:
position = -61
score = 5.48721
sequence = CAATGAGAACCCATCTCATTT

Gene: Smlt3227: Ferredoxin--NADP(+) reductase (EC 1.18.1.2)
Ferredoxin--NADP(+) reductase (EC 1.18.1.2)
 
CRON 6.
feoA
*
Xylella fastidiosa 9a5c

Site:
position = -34
score = 4.68174
sequence = TATTGAGAACGATTCTTGTCA

Gene: XF0932: Ferrous iron transport protein A
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -35
score = 4.63126
sequence = AATTGAGAACCATTCCTAACA

Gene: XAC1854: Ferrous iron transport protein A
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -35
score = 4.63126
sequence = AATTGAGAACCATTCCTAACA

Gene: XCC1834: Ferrous iron transport protein A
*
Stenotrophomonas maltophilia K279a

Site:
position = -38
score = 4.47351
sequence = AATCGAGAACCATTTACATCC

Gene: Smlt2210: Ferrous iron transport protein A
Ferrous iron transport protein A
feoB
 
Xylella fastidiosa 9a5c

Gene: XF0933: Ferrous iron transport protein B
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC1855: Ferrous iron transport protein B
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC1835: Ferrous iron transport protein B
 
Stenotrophomonas maltophilia K279a

Gene: Smlt2211: Ferrous iron transport protein B
Ferrous iron transport protein B
XF0934
 
Xylella fastidiosa 9a5c

Gene: XF0934: conserved hypothetical protein
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC1856: conserved hypothetical protein
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC1836: conserved hypothetical protein
 
Stenotrophomonas maltophilia K279a

Gene: Smlt2212: conserved hypothetical protein
conserved hypothetical protein
 
CRON 7.
fhuE
 
Xylella fastidiosa 9a5c
*2
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -120
score = 5.95085
sequence = AAATGTGAATCATTCCCATTA

Gene: XAC3370: Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid, TonB-dependent

Gene: XAC3498: Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid, TonB-dependent
*2
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -121
score = 5.95085
sequence = AAATGTGAATCATTCCCATTA

Gene: XCC3216: Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid, TonB-dependent

Gene: XCC3215: Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid, TonB-dependent
 
Stenotrophomonas maltophilia K279a
Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid, TonB-dependent
 
CRON 8.
fpvA
 
Xylella fastidiosa 9a5c
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -175
score = 5.56948
sequence = AAACGATAACGATTTACATTT

Gene: XAC0176: Putative receptor for Fe(III)-coprogen, Fe(III)-ferrioxamine B and Fe(III)-rhodotrulic acid, TonB-dependent
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -167
score = 5.56948
sequence = AAACGATAACGATTTACATTT

Gene: XCC0158: Putative receptor for Fe(III)-coprogen, Fe(III)-ferrioxamine B and Fe(III)-rhodotrulic acid, TonB-dependent
*
Stenotrophomonas maltophilia K279a

Site:
position = -136
score = 4.46017
sequence = TGTTAAGAATTATTTACATTT

Gene: Smlt1233: Putative receptor for Fe(III)-coprogen, Fe(III)-ferrioxamine B and Fe(III)-rhodotrulic acid, TonB-dependent
Putative receptor for Fe(III)-coprogen, Fe(III)-ferrioxamine B and Fe(III)-rhodotrulic acid, TonB-dependent
 
CRON 9.
pfeA
 
Xylella fastidiosa 9a5c
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -177
score = 4.90803
sequence = ATTTGAGAATGAATCGCATCT

Gene: XAC3620: Outer membrane receptor for ferrienterochelin, TonB-dependent
 
Xanthomonas campestris pv. campestris str. ATCC 33913
*
Stenotrophomonas maltophilia K279a

Site:
position = -142
score = 4.84844
sequence = ATTTGAGAATCACTCGCATTG

Gene: Smlt1426: Outer membrane receptor for ferrienterochelin, TonB-dependent
Outer membrane receptor for ferrienterochelin, TonB-dependent
 
CRON 10.
fecI
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913
*
Stenotrophomonas maltophilia K279a

Site:
position = -28
score = 5.7748
sequence = TAATGGGAATCATTCGCATTA

Gene: Smlt2848: Putative RNA polymerase sigma factor for iron metabolism
Putative RNA polymerase sigma factor for iron metabolism
fecR
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913
 
Stenotrophomonas maltophilia K279a

Gene: Smlt2849: Putative transmembrane FecR family iron uptake regulator protein
Putative transmembrane FecR family iron uptake regulator protein
fecA
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913
 
Stenotrophomonas maltophilia K279a

Gene: Smlt2850: putative TonB dependent extracellular heme-binding protein
putative TonB dependent extracellular heme-binding protein
 
CRON 11.
XAC0271
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC0271: Putative iron uptake protein
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC0252: Putative iron uptake protein
*
Stenotrophomonas maltophilia K279a

Site:
position = -126
score = 5.59226
sequence = AAATGCGAATGCCTATCATTT

Gene: Smlt1567: Putative iron uptake protein
Putative iron uptake protein
pepSY
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC0270: putative transmembrane PepSY domain protein
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC0251: putative transmembrane PepSY domain protein
 
Stenotrophomonas maltophilia K279a

Gene: Smlt1566: putative transmembrane PepSY domain protein
putative transmembrane PepSY domain protein
XAC0269
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC0269: Putative iron uptake protein
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC0250: Putative iron uptake protein
 
Stenotrophomonas maltophilia K279a

Gene: Smlt1565: Putative iron uptake protein
Putative iron uptake protein
 
CRON 12.
fecI2
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913
*
Stenotrophomonas maltophilia K279a

Site:
position = -86
score = 5.38769
sequence = AAACGCGAACGGTTCCCATTA

Gene: Smlt2664: putative RNA polymerase sigma factor for iron metabolism
putative RNA polymerase sigma factor for iron metabolism
fecR2
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913
 
Stenotrophomonas maltophilia K279a

Gene: Smlt2665: putative iron uptake transcriptional regulator protein
putative iron uptake transcriptional regulator protein
fecA2
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913
 
Stenotrophomonas maltophilia K279a

Gene: Smlt2666: putative TonB-dependent ferric siderophore receptor
putative TonB-dependent ferric siderophore receptor
 
CRON 13.
Smlt1145
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913
*
Stenotrophomonas maltophilia K279a

Site:
position = -99
score = 5.27106
sequence = TTTTGGCAATCATTCTCATTT

Site:
position = -76
score = 4.13244
sequence = AACGGCTAACAGCTCTCATTA

Gene: Smlt1145: putative transmembrane protein
putative transmembrane protein
bfrA
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913
 
Stenotrophomonas maltophilia K279a

Gene: Smlt1144c: putative exogenous ferric siderophore receptor, TonB-dependent
putative exogenous ferric siderophore receptor, TonB-dependent
 
CRON 14.
fpvA
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -72
score = 5.18391
sequence = TAATAATATTCATTCTCACTT

Gene: XCC3518: Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid, TonB-dependent
 
Stenotrophomonas maltophilia K279a
Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid, TonB-dependent
 
CRON 15.
COG1272
*
Xylella fastidiosa 9a5c

Site:
position = -37
score = 5.10574
sequence = AAATGCGAATTATTCGCGGTT

Gene: XF0175: Predicted membrane protein hemolysin III homolog
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -37
score = 4.26428
sequence = CGATGCGAATCGCTCGCAATT

Gene: XAC3043: Predicted membrane protein hemolysin III homolog
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC2860: Predicted membrane protein hemolysin III homolog
 
Stenotrophomonas maltophilia K279a

Gene: Smlt3638: Predicted membrane protein hemolysin III homolog
Predicted membrane protein hemolysin III homolog
 
CRON 16.
fecI3
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913
*
Stenotrophomonas maltophilia K279a

Site:
position = -69
score = 5.05638
sequence = GAACGTGACTGATTCTCATTA

Gene: Smlt3900: putative RNA polymerase ECF sigma factor for iron metabolism
putative RNA polymerase ECF sigma factor for iron metabolism
fecR3
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913
 
Stenotrophomonas maltophilia K279a

Gene: Smlt3899: putative transmembrane FecR sensor protein
putative transmembrane FecR sensor protein
fecA3
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913
 
Stenotrophomonas maltophilia K279a

Gene: Smlt3898: putative extracellular heme-binding protein, TonB-dependent
putative extracellular heme-binding protein, TonB-dependent
 
CRON 17.
COG4771
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913
*
Stenotrophomonas maltophilia K279a

Site:
position = 4
score = 4.99324
sequence = AATCAGCAATAATTCTCATTT

Gene: Smlt2858: Outer membrane receptor for ferrienterochelin, TonB-dependent
Outer membrane receptor for ferrienterochelin, TonB-dependent
 
CRON 18.
fhuE
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913
*
Stenotrophomonas maltophilia K279a

Site:
position = -94
score = 4.81624
sequence = AAATAGGAATAGTTCGTATTA

Gene: Smlt3999: Putative TonB-dependent receptor for Fe(III)-coprogen, Fe(III)-ferrioxamine B and Fe(III)-rhodotrulic acid, TonB-dependent
Putative TonB-dependent receptor for Fe(III)-coprogen, Fe(III)-ferrioxamine B and Fe(III)-rhodotrulic acid, TonB-dependent
 
CRON 19.
fecI4
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913
*
Stenotrophomonas maltophilia K279a

Site:
position = -87
score = 4.61891
sequence = GGATGCAAATGATTCTCTTTT

Gene: Smlt2935: putative ECF-family sigma factor for iron metabolism
putative ECF-family sigma factor for iron metabolism
fecR4
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913
 
Stenotrophomonas maltophilia K279a

Gene: Smlt2936: putative transcriptional regulatory FecR iron transport regulator family protein
putative transcriptional regulatory FecR iron transport regulator family protein
fecA4
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913
 
Stenotrophomonas maltophilia K279a

Gene: Smlt2937: putative TonB dependent receptor protein
putative TonB dependent receptor protein
Smlt2938
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913
 
Stenotrophomonas maltophilia K279a

Gene: Smlt2938: putative iron regulated lipoprotein
putative iron regulated lipoprotein
Smlt2939
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913
 
Stenotrophomonas maltophilia K279a

Gene: Smlt2939: putative TonB-like protein
putative TonB-like protein
 
CRON 20.
COG4773
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -31
score = 4.61897
sequence = GGATAAGAATCGTTATCATTG

Gene: XCC4162: Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid, TonB-dependent
 
Stenotrophomonas maltophilia K279a
Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid, TonB-dependent
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD