Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Fur - Psychromonadaceae/Aeromonadales

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 111 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Psychromonas ingrahamii 37 5 3
Psychromonas sp. CNPT3 23 8
Moritella sp. PE36 58 23
Aeromonas hydrophila subsp. hydrophila ATCC 7966 54 24
Aeromonas salmonicida subsp. salmonicida A449 55 24
Tolumonas auensis DSM 9187 21 8
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
PE36_02327
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -94
score = 6.17115
sequence = TAATGAAAATTGTTATCATTT

Gene: PE36_02327: Ferric siderophore receptor-like protein, TonB-dependent
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Ferric siderophore receptor-like protein, TonB-dependent
fecF
 
Psychromonas ingrahamii 37
*
Psychromonas sp. CNPT3

Site:
position = -85
score = 5.11997
sequence = TAGTGATTATTGTTATCATTT

Site:
position = -91
score = 4.86819
sequence = AAATGATAGTGATTATTGTTA

Gene: PCNPT3_08705: Iron(III) dicitrate transport system periplasmic substrate-binding transport protein
 
Moritella sp. PE36

Gene: PE36_02322: Iron(III) dicitrate transport system periplasmic substrate-binding transport protein
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Iron(III) dicitrate transport system periplasmic substrate-binding transport protein
fecD
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3

Gene: PCNPT3_08710: Iron(III) dicitrate transport system permease protein FecD (TC 3.A.1.14.1)
 
Moritella sp. PE36

Gene: PE36_02317: Iron(III) dicitrate transport system permease protein FecD (TC 3.A.1.14.1)
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Iron(III) dicitrate transport system permease protein FecD (TC 3.A.1.14.1)
fecE
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3

Gene: PCNPT3_08715: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)
 
Moritella sp. PE36

Gene: PE36_02312: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)
PE36_02307
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_02307: TonB system biopolymer transport component; Chromosome segregation ATPase
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -59
score = 5.39528
sequence = CAATGAGAATAGTTATCATTG

Gene: AHA_4252: TonB system biopolymer transport component; Chromosome segregation ATPase
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -35
score = 5.39528
sequence = CAATGAGAATAGTTATCATTG

Gene: ASA_4323: TonB system biopolymer transport component; Chromosome segregation ATPase
 
Tolumonas auensis DSM 9187
TonB system biopolymer transport component; Chromosome segregation ATPase
AHA_4251
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_02302: TonB system biopolymer transport component
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_4251: TonB system biopolymer transport component
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_4322: TonB system biopolymer transport component
 
Tolumonas auensis DSM 9187
TonB system biopolymer transport component
exbB2
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_02297: Ferric siderophore transport system, biopolymer transport protein ExbB
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_4250: Ferric siderophore transport system, biopolymer transport protein ExbB
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_4321: Ferric siderophore transport system, biopolymer transport protein ExbB
 
Tolumonas auensis DSM 9187
Ferric siderophore transport system, biopolymer transport protein ExbB
exbD2
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_02292: Ferric siderophore transport system, biopolymer transport protein ExbD
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_4249: Ferric siderophore transport system, biopolymer transport protein ExbD
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_4320: Ferric siderophore transport system, biopolymer transport protein ExbD
 
Tolumonas auensis DSM 9187
Ferric siderophore transport system, biopolymer transport protein ExbD
tonB2
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_02287: Ferric siderophore transport system, periplasmic binding protein TonB
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_4248: Ferric siderophore transport system, periplasmic binding protein TonB
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_4319: Ferric siderophore transport system, periplasmic binding protein TonB
 
Tolumonas auensis DSM 9187
Ferric siderophore transport system, periplasmic binding protein TonB
PE36_02282
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_02282: TPR domain protein, putative component of TonB system
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_4247: TPR domain protein, putative component of TonB system
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_4318: TPR domain protein, putative component of TonB system
 
Tolumonas auensis DSM 9187
TPR domain protein, putative component of TonB system
 
CRON 2.
fbpA
*
Psychromonas ingrahamii 37

Site:
position = -32
score = 4.50541
sequence = TATCGTGAATTATTACCATTT

Site:
position = -56
score = 5.23317
sequence = TAATGATTATCATTATTATTA

Site:
position = -62
score = 5.89577
sequence = AAATGGTAATGATTATCATTA

Gene: Ping_3007: Ferric iron ABC transporter, iron-binding protein
*2
Psychromonas sp. CNPT3

Site:
position = -32
score = 5.17198
sequence = AATTGATAATCATTATTACCA

Gene: PCNPT3_11948: Ferric iron ABC transporter, iron-binding protein

Gene: PCNPT3_11943: Ferric iron ABC transporter, iron-binding protein
*
Moritella sp. PE36

Site:
position = -102
score = 5.97095
sequence = TTATGAGAATTATTATCATTT

Gene: PE36_07672: Ferric iron ABC transporter, iron-binding protein
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_0650: Ferric iron ABC transporter, iron-binding protein
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_0650: Ferric iron ABC transporter, iron-binding protein
*
Tolumonas auensis DSM 9187

Site:
position = -37
score = 5.80183
sequence = TTATGATAATGATTCTCATTA

Site:
position = -60
score = 5.46643
sequence = AAATGATATCCGTTCTCATAT

Site:
position = -87
score = 5.60668
sequence = AAACGATATTTATTTTCATTT

Gene: Tola_2559: Ferric iron ABC transporter, iron-binding protein
Ferric iron ABC transporter, iron-binding protein
fbpB
 
Psychromonas ingrahamii 37

Gene: Ping_3006: Ferric iron ABC transporter, permease protein
 
Psychromonas sp. CNPT3

Gene: PCNPT3_11938: Ferric iron ABC transporter, permease protein
 
Moritella sp. PE36

Gene: PE36_07667: Ferric iron ABC transporter, permease protein
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_0651: Ferric iron ABC transporter, permease protein
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_0651: Ferric iron ABC transporter, permease protein
 
Tolumonas auensis DSM 9187

Gene: Tola_2558: Ferric iron ABC transporter, permease protein
Ferric iron ABC transporter, permease protein
fbpC
 
Psychromonas ingrahamii 37

Gene: Ping_3005: Ferric iron ABC transporter, ATP-binding protein
 
Psychromonas sp. CNPT3

Gene: PCNPT3_11933: Ferric iron ABC transporter, ATP-binding protein
 
Moritella sp. PE36

Gene: PE36_07662: Ferric iron ABC transporter, ATP-binding protein
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_0652: Ferric iron ABC transporter, ATP-binding protein
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_0652: Ferric iron ABC transporter, ATP-binding protein
 
Tolumonas auensis DSM 9187

Gene: Tola_2557: Ferric iron ABC transporter, ATP-binding protein
Ferric iron ABC transporter, ATP-binding protein
 
CRON 3.
PCNPT3_11763
 
Psychromonas ingrahamii 37
*
Psychromonas sp. CNPT3

Site:
position = -111
score = 5.39171
sequence = GAATGAGAACTATTCTCGTTT

Site:
position = -156
score = 4.97742
sequence = TATTGATAATGACTTTCATTG

Gene: PCNPT3_11763: hypothetical protein
*
Moritella sp. PE36

Site:
position = -58
score = 5.3559
sequence = TAATACGAACCATTCTCATTA

Gene: PE36_14199: hypothetical protein
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -71
score = 5.12272
sequence = TAATGCACACCATTCTCATTT

Gene: AHA_2481: hypothetical protein
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -71
score = 5.12272
sequence = TAATGCACACCATTCTCATTT

Gene: ASA_1836: hypothetical protein
 
Tolumonas auensis DSM 9187
hypothetical protein
PCNPT3_11758
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3

Gene: PCNPT3_11758: hypothetical protein
 
Moritella sp. PE36

Gene: PE36_14204: hypothetical protein
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -80
score = 5.54753
sequence = AATTGATAACTCTTTTCATTA

Gene: AHA_2544: hypothetical protein
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -80
score = 5.54753
sequence = AATTGATAACTCTTTTCATTA

Gene: ASA_2551: hypothetical protein
 
Tolumonas auensis DSM 9187
hypothetical protein
PCNPT3_11733
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3

Gene: PCNPT3_11733: hypothetical protein
*
Moritella sp. PE36

Site:
position = -58
score = 5.26067
sequence = TAATGATAACCATTCTTAATC

Gene: PE36_14229: hypothetical protein
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
hypothetical protein
 
CRON 4.
COG3205
*
Psychromonas ingrahamii 37

Site:
position = -57
score = 6.20462
sequence = AAATGATAACAGTTATCATTT

Gene: Ping_0309: Predicted membrane protein
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -70
score = 6.07702
sequence = AGATGAGAATAGTTTTCATTT

Gene: AHA_3578: Predicted membrane protein
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -70
score = 6.07702
sequence = AGATGAGAATAGTTTTCATTT

Gene: ASA_3536: Predicted membrane protein
 
Tolumonas auensis DSM 9187
Predicted membrane protein
 
CRON 5.
fhuA
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -134
score = 5.28778
sequence = AGATGCAAATGATTAGCAATT

Gene: AHA_4275: Ferric hydroxamate outer membrane receptor FhuA
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -155
score = 5.28778
sequence = AGATGCAAATGATTAGCAATT

Gene: ASA_4363: Ferric hydroxamate outer membrane receptor FhuA
 
Tolumonas auensis DSM 9187
Ferric hydroxamate outer membrane receptor FhuA
fhuB
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -2
score = 4.7848
sequence = TAATGAAAATTAAATTGATTT

Site:
position = -103
score = 4.86189
sequence = AAATGAGAATGATTAATGTTA

Gene: PE36_19080: ABC transporter ATP-binding protein YojI
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_4276: ABC transporter ATP-binding protein YojI
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_4364: ABC transporter ATP-binding protein YojI
*
Tolumonas auensis DSM 9187

Site:
position = -38
score = 5.0959
sequence = TAATGGGAATAGTTATCAGTA

Gene: Tola_1489: ABC transporter ATP-binding protein YojI
ABC transporter ATP-binding protein YojI
fhuC
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_4277: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), ATP-binding protein FhuC
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_4365: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), ATP-binding protein FhuC
*
Tolumonas auensis DSM 9187

Site:
position = -60
score = 5.90495
sequence = AATTGATAACAATTATCATCT

Gene: Tola_1485: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), ATP-binding protein FhuC
Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), ATP-binding protein FhuC
fhuD
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_4278: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), periplasmic substrate binding protein FhuD
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_4366: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), periplasmic substrate binding protein FhuD
 
Tolumonas auensis DSM 9187

Gene: Tola_1486: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), periplasmic substrate binding protein FhuD
Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), periplasmic substrate binding protein FhuD
fhuE
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_4279: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), permease component FhuB
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_4367: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), permease component FhuB
 
Tolumonas auensis DSM 9187

Gene: Tola_1487: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), permease component FhuB
Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), permease component FhuB
 
CRON 6.
hutX
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -86
score = 5.15592
sequence = AAATGAGAATTGGTTGCATTA

Gene: PE36_06592: Putative heme iron utilization protein
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -97
score = 5.0469
sequence = GAATGAAAGCGATTATCAATT

Gene: AHA_0967: Putative heme iron utilization protein
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -97
score = 5.0469
sequence = GAATGAAAGCGATTATCAATT

Gene: ASA_3333: Putative heme iron utilization protein
 
Tolumonas auensis DSM 9187
Putative heme iron utilization protein
hutZ
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_06597: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_0968: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_3332: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ
 
Tolumonas auensis DSM 9187
Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ
 
CRON 7.
hutB
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -150
score = 5.15592
sequence = TAATGCAACCAATTCTCATTT

Gene: PE36_06587: Hemin ABC transport system, periplasmic component
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -92
score = 5.0469
sequence = AATTGATAATCGCTTTCATTC

Gene: AHA_0966: Hemin ABC transport system, periplasmic component
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -92
score = 5.0469
sequence = AATTGATAATCGCTTTCATTC

Gene: ASA_3334: Hemin ABC transport system, periplasmic component
 
Tolumonas auensis DSM 9187
Hemin ABC transport system, periplasmic component
hutC
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_06582: Hemin ABC transporter, permease protein
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_0965: Hemin ABC transporter, permease protein
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_3335: Hemin ABC transporter, permease protein
 
Tolumonas auensis DSM 9187
Hemin ABC transporter, permease protein
hutD
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_06577: Hemin ABC transporter, ATP-binding protein
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_0964: Hemin ABC transporter, ATP-binding protein
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_3336: Hemin ABC transporter, ATP-binding protein
 
Tolumonas auensis DSM 9187
Hemin ABC transporter, ATP-binding protein
 
CRON 8.
sitA
 
Psychromonas ingrahamii 37
*
Psychromonas sp. CNPT3

Site:
position = -74
score = 5.13317
sequence = TAATGATTATCGTTTGCATTT

Site:
position = -80
score = 5.19087
sequence = TCATGATAATGATTATCGTTT

Gene: PCNPT3_07645: Manganese ABC transporter, periplasmic-binding protein SitA
*
Moritella sp. PE36

Site:
position = -85
score = 6.34949
sequence = TAATGATAATAATTCTCATTT

Gene: PE36_17360: Manganese ABC transporter, periplasmic-binding protein SitA
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Manganese ABC transporter, periplasmic-binding protein SitA
sitB
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3

Gene: PCNPT3_07650: Manganese ABC transporter, ATP-binding protein SitB
 
Moritella sp. PE36

Gene: PE36_17355: Manganese ABC transporter, ATP-binding protein SitB
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Manganese ABC transporter, ATP-binding protein SitB
sitC
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3

Gene: PCNPT3_07655: Manganese ABC transporter, inner membrane permease protein SitC
 
Moritella sp. PE36

Gene: PE36_17350: Manganese ABC transporter, inner membrane permease protein SitC
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Manganese ABC transporter, inner membrane permease protein SitC
sitD
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3

Gene: PCNPT3_07660: Manganese ABC transporter, inner membrane permease protein SitD
 
Moritella sp. PE36

Gene: PE36_17345: Manganese ABC transporter, inner membrane permease protein SitD
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Manganese ABC transporter, inner membrane permease protein SitD
 
CRON 9.
mntH
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -46
score = 6.29928
sequence = AATTGATAATAATTATCATTT

Gene: AHA_0709: Manganese transport protein MntH
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -61
score = 6.14395
sequence = AATTGATAACAATTATCATTT

Gene: ASA_0706: Manganese transport protein MntH
 
Tolumonas auensis DSM 9187
Manganese transport protein MntH
 
CRON 10.
entC
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -44
score = 6.00891
sequence = AACTGATAATCATTATCATTT

Gene: AHA_2479: Isochorismate synthase (EC 5.4.4.2)
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -119
score = 6.28548
sequence = AATTGATAATCATTATCATTT

Gene: ASA_1838: Isochorismate synthase (EC 5.4.4.2)
 
Tolumonas auensis DSM 9187
Isochorismate synthase (EC 5.4.4.2)
entE
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_2478: 2,3-dihydroxybenzoate-AMP ligase (EC 2.7.7.58)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_1839: 2,3-dihydroxybenzoate-AMP ligase (EC 2.7.7.58)
 
Tolumonas auensis DSM 9187
2,3-dihydroxybenzoate-AMP ligase (EC 2.7.7.58)
entB
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_2477: Isochorismatase (EC 3.3.2.1) of siderophore biosynthesis
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_1840: Isochorismatase (EC 3.3.2.1) of siderophore biosynthesis
 
Tolumonas auensis DSM 9187
Isochorismatase (EC 3.3.2.1) of siderophore biosynthesis
entF
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_2476: Enterobactin synthetase component F (EC 2.7.7.-)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_1841: Enterobactin synthetase component F (EC 2.7.7.-)
 
Tolumonas auensis DSM 9187
Enterobactin synthetase component F (EC 2.7.7.-)
entA
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_2475: 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (EC 1.3.1.28)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_1842: 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (EC 1.3.1.28)
 
Tolumonas auensis DSM 9187
2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (EC 1.3.1.28)
 
CRON 11.
AHA_2992
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -60
score = 6.26581
sequence = AATTGATAATAATTTTCATTT

Gene: AHA_2992: iron-chelator utilization protein
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -60
score = 6.11048
sequence = AATTGATAATAGTTTTCATTT

Gene: ASA_3006: iron-chelator utilization protein
 
Tolumonas auensis DSM 9187
iron-chelator utilization protein
 
CRON 12.
AHA_0514
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -90
score = 6.21918
sequence = AAATAATAATTATTATCATTT

Gene: AHA_0514: FOG: TPR repeat
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -35
score = 6.21918
sequence = AAATAATAATTATTATCATTT

Gene: ASA_3720: FOG: TPR repeat
 
Tolumonas auensis DSM 9187
FOG: TPR repeat
sodA
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_0515: Manganese superoxide dismutase (EC 1.15.1.1)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_3721: Manganese superoxide dismutase (EC 1.15.1.1)
 
Tolumonas auensis DSM 9187
Manganese superoxide dismutase (EC 1.15.1.1)
 
CRON 13.
AHA_1970
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = 109
score = 5.72154
sequence = AAATAAAAATGATTACCATTT

Gene: AHA_1970: hypothetical protein
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -80
score = 5.72154
sequence = AAATAAAAATGATTACCATTT

Gene: ASA_1851: hypothetical protein
 
Tolumonas auensis DSM 9187
hypothetical protein
fstC
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1969: Colicin I receptor precursor
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_1850: Colicin I receptor precursor
 
Tolumonas auensis DSM 9187
Colicin I receptor precursor
AHA_1968
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1968: ABC-type Fe3+-siderophore transport system, permease component
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_1849: ABC-type Fe3+-siderophore transport system, permease component
 
Tolumonas auensis DSM 9187
ABC-type Fe3+-siderophore transport system, permease component
AHA_1967
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1967: ABC-type Fe3+-siderophore transport system, permease component
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_1848: ABC-type Fe3+-siderophore transport system, permease component
 
Tolumonas auensis DSM 9187
ABC-type Fe3+-siderophore transport system, permease component
fecE
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1966: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_1847: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)
 
Tolumonas auensis DSM 9187
Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)
 
CRON 14.
hutR
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
*2
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -90
score = 4.70578
sequence = AAATGAGAATGATTCCGTTTA

Site:
position = -31
score = 4.82069
sequence = GTTTGATAACAGTTCTCAATA

Gene: AHA_0972: TonB-dependent heme receptor HutR

Site:
position = -88
score = 5.87786
sequence = AAATGATAATGATTATCAATC

Site:
position = -20
score = 5.83741
sequence = AAATAATAATTATTCTCAATA

Gene: AHA_1663: TonB-dependent heme receptor HutR
*2
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -47
score = 5.14653
sequence = AAATAACAATCATTCTCAAAA

Site:
position = -115
score = 5.87786
sequence = AAATGATAATGATTATCAATC

Gene: ASA_2695: TonB-dependent heme receptor HutR

Site:
position = -90
score = 5.21701
sequence = AAATGAGAATGATTCCCTTTA

Site:
position = -31
score = 4.82069
sequence = GTTTGATAACAGTTCTCAATA

Gene: ASA_3328: TonB-dependent heme receptor HutR
 
Tolumonas auensis DSM 9187
TonB-dependent heme receptor HutR
 
CRON 15.
AHA_0461
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -112
score = 5.82195
sequence = TAATGAAAATCAATATCATTA

Gene: AHA_0461: Ferrichrome-iron receptor
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -110
score = 5.82195
sequence = TAATGAAAATCAATATCATTA

Gene: ASA_3883: Ferrichrome-iron receptor
 
Tolumonas auensis DSM 9187
Ferrichrome-iron receptor
 
CRON 16.
AHA_1964
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -93
score = 5.8091
sequence = AAATGACAATTCTTATCATTT

Gene: AHA_1964: Iron(III) dicitrate transport system, periplasmic iron-binding protein FecB (TC 3.A.1.14.1)
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -93
score = 5.73962
sequence = AAATGACAATTTTTATCATTT

Gene: ASA_1845: Iron(III) dicitrate transport system, periplasmic iron-binding protein FecB (TC 3.A.1.14.1)
 
Tolumonas auensis DSM 9187
Iron(III) dicitrate transport system, periplasmic iron-binding protein FecB (TC 3.A.1.14.1)
 
CRON 17.
entD
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -84
score = 5.8091
sequence = AAATGATAAGAATTGTCATTT

Gene: AHA_1965: 4'-phosphopantetheinyl transferase entD (EC 2.7.8.-)
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -86
score = 5.73962
sequence = AAATGATAAAAATTGTCATTT

Gene: ASA_1846: 4'-phosphopantetheinyl transferase entD (EC 2.7.8.-)
 
Tolumonas auensis DSM 9187
4'-phosphopantetheinyl transferase entD (EC 2.7.8.-)
 
CRON 18.
Tola_0678
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
*
Tolumonas auensis DSM 9187

Site:
position = -54
score = 5.76218
sequence = TATTGAGAATAATTATCAATA

Gene: Tola_0678: TonB-dependent receptor
TonB-dependent receptor
PE36_17585
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -35
score = 5.53547
sequence = TAATACGAACAATTATCATTT

Gene: PE36_17585: Ferric anguibactin-binding protein
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187

Gene: Tola_0677: Ferric anguibactin-binding protein
Ferric anguibactin-binding protein
PE36_17590
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_17590: catechol siderophore ABC transporter, permease protein
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_4372: catechol siderophore ABC transporter, permease protein
 
Tolumonas auensis DSM 9187

Gene: Tola_0676: catechol siderophore ABC transporter, permease protein
catechol siderophore ABC transporter, permease protein
PE36_17595
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_17595: ferric anguibactin transport system permease protein FatC
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_4371: ferric anguibactin transport system permease protein FatC
 
Tolumonas auensis DSM 9187

Gene: Tola_0675: ferric anguibactin transport system permease protein FatC
ferric anguibactin transport system permease protein FatC
PE36_17600
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_17600: ferric anguibactin transport ATP-binding protein
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_4370: ferric anguibactin transport ATP-binding protein
 
Tolumonas auensis DSM 9187

Gene: Tola_0674: ferric anguibactin transport ATP-binding protein
ferric anguibactin transport ATP-binding protein
Tola_0673
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187

Gene: Tola_0673: ABC transporter domain protein
ABC transporter domain protein
PE36_17605
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_17605: vulnibactin utilization protein ViuB
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
vulnibactin utilization protein ViuB
 
CRON 19.
PE36_21674
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -71
score = 5.61407
sequence = TAGTGACAATGATTCTCATTT

Gene: PE36_21674: permease
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
permease
PE36_21669
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_21669: probable TonB-dependent receptor
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
probable TonB-dependent receptor
PE36_21664
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_21664: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)
PE36_21659
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_21659: ABC-type Fe3+-hydroxamate transport system, periplasmic component
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
ABC-type Fe3+-hydroxamate transport system, periplasmic component
PE36_21654
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_21654: ferrichrome transport system permease protein FhuB
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
ferrichrome transport system permease protein FhuB
 
CRON 20.
hugW
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -42
score = 5.33267
sequence = TATTGATAGTGGTTATCATTT

Gene: AHA_1982: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -51
score = 5.48799
sequence = AATTGATAGTGGTTATCATTT

Gene: ASA_1862: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake
 
Tolumonas auensis DSM 9187
Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake
 
CRON 21.
feoA
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3

Gene: PCNPT3_04751: Ferrous iron transport protein A
 
Moritella sp. PE36

Gene: PE36_13484: Ferrous iron transport protein A
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -38
score = 5.01116
sequence = AAAAGAGAATTATTATTGTTT

Gene: AHA_2744: Ferrous iron transport protein A
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -38
score = 4.64855
sequence = AAAAGCGAATTATTATTGTTT

Gene: ASA_1629: Ferrous iron transport protein A
*
Tolumonas auensis DSM 9187

Site:
position = -35
score = 5.4523
sequence = TATTAATAATGATTCTCAATA

Gene: Tola_2146: Ferrous iron transport protein A
Ferrous iron transport protein A
feoB
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3

Gene: PCNPT3_04756: Ferrous iron transport protein B
 
Moritella sp. PE36

Gene: PE36_13479: Ferrous iron transport protein B
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_2743: Ferrous iron transport protein B
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_1630: Ferrous iron transport protein B
 
Tolumonas auensis DSM 9187

Gene: Tola_2145: Ferrous iron transport protein B
Ferrous iron transport protein B
feoC
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3

Gene: PCNPT3_04761: Ferrous iron transport protein C
 
Moritella sp. PE36

Gene: PE36_13474: Ferrous iron transport protein C
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_2742: Ferrous iron transport protein C
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_1631: Ferrous iron transport protein C
 
Tolumonas auensis DSM 9187

Gene: Tola_2144: Ferrous iron transport protein C
Ferrous iron transport protein C
 
CRON 22.
AHA_3963
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -189
score = 6.01409
sequence = TAATGAGATTAATTATCATTT

Gene: AHA_3963: TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins
 
CRON 23.
tonB1
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -123
score = 4.58819
sequence = GATTGATAATGGTTGTTGTTT

Gene: AHA_1987: Ferric siderophore transport system, periplasmic binding protein TonB
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -33
score = 4.90053
sequence = GATTGATAATAGTTATTGTTT

Gene: ASA_1867: Ferric siderophore transport system, periplasmic binding protein TonB
*
Tolumonas auensis DSM 9187

Site:
position = -79
score = 5.88429
sequence = AAATAATAATGGTTCTCATTA

Gene: Tola_1802: Ferric siderophore transport system, periplasmic binding protein TonB
Ferric siderophore transport system, periplasmic binding protein TonB
exbB1
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1986: Biopolymer transport protein ExbB
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_1866: Biopolymer transport protein ExbB
 
Tolumonas auensis DSM 9187

Gene: Tola_1801: Biopolymer transport protein ExbB
Ferric siderophore transport system, biopolymer transport protein ExbB
exbD1
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1985: Biopolymer transport protein ExbD
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_1865: Biopolymer transport protein ExbD
 
Tolumonas auensis DSM 9187

Gene: Tola_1800: Biopolymer transport protein ExbD
Ferric siderophore transport system, biopolymer transport protein ExbD
 
CRON 24.
fstB
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -94
score = 5.83651
sequence = AAATGATATTCATTTTTATTT

Site:
position = -100
score = 4.87526
sequence = AGATACAAATGATATTCATTT

Gene: ASA_4368: Ferrichrome-iron receptor
 
Tolumonas auensis DSM 9187
Ferrichrome-iron receptor
 
CRON 25.
PE36_01637
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -108
score = 4.82923
sequence = TAATGAAAATGGTAATGATTA

Site:
position = -102
score = 5.83511
sequence = AAATGGTAATGATTATCAATT

Gene: PE36_01637: putative putative ferrichrome-iron receptor
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
putative putative ferrichrome-iron receptor
 
CRON 26.
PE36_11667
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -53
score = 5.7981
sequence = AATTGATAATAAATCTCATTA

Site:
position = -70
score = 4.75089
sequence = TAATGATTTTTATTTGCAATT

Site:
position = -76
score = 4.89319
sequence = CTGTGATAATGATTTTTATTT

Gene: PE36_11667: hypothetical protein
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
hypothetical protein
PE36_11662
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_11662: ABC transporter, ATP-binding protein
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
ABC transporter, ATP-binding protein
 
CRON 27.
PE36_10008
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -197
score = 4.51615
sequence = TAAAGATTATCTTTTTCATTT

Site:
position = -85
score = 5.73742
sequence = AATTGCGAATAGTTTTCATTT

Gene: PE36_10008: hypothetical protein
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_0741: hypothetical protein
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_3611: hypothetical protein
 
Tolumonas auensis DSM 9187
hypothetical protein
 
CRON 28.
PCNPT3_10053
 
Psychromonas ingrahamii 37
*
Psychromonas sp. CNPT3

Site:
position = -57
score = 5.73742
sequence = AATTGCAAATAATTCTCATTA

Gene: PCNPT3_10053: ABC transporter ATP-binding protein
*
Moritella sp. PE36

Site:
position = -42
score = 4.61343
sequence = TATTGGTTATCATTCTCATCA

Gene: PE36_21074: ABC transporter ATP-binding protein
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
ABC transporter ATP-binding protein
PE36_21069
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_21069: putative Iron-compound ABC transporter, permease protein
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
putative Iron-compound ABC transporter, permease protein
PE36_21064
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_21064: iron(III) dicitrate transport system permease protein
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
iron(III) dicitrate transport system permease protein
PE36_21059
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_21059: putative ferrichrome-binding protein
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
putative ferrichrome-binding protein
 
CRON 29.
ftr1
 
Psychromonas ingrahamii 37
*
Psychromonas sp. CNPT3

Site:
position = -58
score = 5.69358
sequence = TAATGGTAATTATTATCAATT

Gene: PCNPT3_00271: High-affinity Fe2+/Pb2+ permease
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
High-affinity Fe2+/Pb2+ permease
PCNPT3_00266
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3

Gene: PCNPT3_00266: Periplasmic protein p19 involved in high-affinity Fe2+ transport
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Periplasmic protein p19 involved in high-affinity Fe2+ transport
 
CRON 30.
PE36_09918
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -79
score = 5.66441
sequence = AAATGAGAATTATTCTTATAA

Gene: PE36_09918: Transcriptional regulator, AraC family
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1952: Transcriptional regulator, AraC family
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_2342: Transcriptional regulator, AraC family
 
Tolumonas auensis DSM 9187
Transcriptional regulator, AraC family
 
CRON 31.
irpA
*
Psychromonas ingrahamii 37

Site:
position = -56
score = 4.85665
sequence = TAATGATAATCAATACTATTC

Site:
position = -62
score = 4.71873
sequence = TTTTGATAATGATAATCAATA

Gene: Ping_0688: Iron-regulated protein A precursor
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -57
score = 4.84459
sequence = CAATGCAAATAACTATCATTA

Site:
position = -80
score = 5.65623
sequence = TAATGATAATAATTATTATTC

Gene: PE36_01255: Iron-regulated protein A precursor
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Iron-regulated protein A precursor
 
CRON 32.
PCNPT3_09369
 
Psychromonas ingrahamii 37
*
Psychromonas sp. CNPT3

Site:
position = -59
score = 5.64244
sequence = GAATAATAATGATTATCATTA

Gene: PCNPT3_09369: Putative periplasmic substrate-binding transport protein
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Putative periplasmic substrate-binding transport protein
PCNPT3_09374
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3

Gene: PCNPT3_09374: Iron(III) dicitrate transport system permease protein FecD (TC 3.A.1.14.1)
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Iron(III) dicitrate transport system permease protein FecD (TC 3.A.1.14.1)
PCNPT3_09379
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3

Gene: PCNPT3_09379: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)
 
CRON 33.
PE36_21679
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -55
score = 5.61407
sequence = AAATGAGAATCATTGTCACTA

Gene: PE36_21679: putative siderophore biosynthesis protein IucC
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
putative siderophore biosynthesis protein IucC
 
CRON 34.
PE36_09923
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -46
score = 5.56794
sequence = GAACGATAATAATTATCATTT

Gene: PE36_09923: ferrichrome-iron receptor
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
ferrichrome-iron receptor
 
CRON 35.
PE36_17310
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -75
score = 5.45503
sequence = GAATGATAGTAATTCTCATTT

Gene: PE36_17310: heme transport protein HutA
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
heme transport protein HutA
 
CRON 36.
Tola_1488
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
*
Tolumonas auensis DSM 9187

Site:
position = -68
score = 5.44644
sequence = TAATGCGAATGGTTATCAATA

Gene: Tola_1488: TonB-dependent siderophore receptor
TonB-dependent siderophore receptor
 
CRON 37.
PE36_08636
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -139
score = 5.41284
sequence = TTATGATAATAATTTTTATCT

Gene: PE36_08636: hypothetical outer membrane protein
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
hypothetical outer membrane protein
 
CRON 38.
AHA_1953
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -43
score = 4.86
sequence = AAATGAGATTTGTTACTATTC

Gene: AHA_1953: Ferrichrome-iron receptor
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -47
score = 5.40839
sequence = AAATGAGATTTGTTACCATTA

Gene: ASA_2341: Ferrichrome-iron receptor
 
Tolumonas auensis DSM 9187
Ferrichrome-iron receptor
AHA_1954
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1954: Hypothetical protein in aerobactin uptake cluster
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_2340: Hypothetical protein in aerobactin uptake cluster
 
Tolumonas auensis DSM 9187
Hypothetical protein in aerobactin uptake cluster
 
CRON 39.
hemC
 
Psychromonas ingrahamii 37

Gene: Ping_3642: Porphobilinogen deaminase (EC 2.5.1.61)
 
Psychromonas sp. CNPT3

Gene: PCNPT3_01645: Porphobilinogen deaminase (EC 2.5.1.61)
 
Moritella sp. PE36

Gene: PE36_15764: Porphobilinogen deaminase (EC 2.5.1.61)
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -105
score = 4.77445
sequence = TAATAAAAATCATTTTCAGCG

Gene: AHA_0469: Porphobilinogen deaminase (EC 2.5.1.61)
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -105
score = 5.39232
sequence = TAATGAAAATCATTTTCAGCA

Gene: ASA_3875: Porphobilinogen deaminase (EC 2.5.1.61)
 
Tolumonas auensis DSM 9187

Gene: Tola_3127: Porphobilinogen deaminase (EC 2.5.1.61)
Porphobilinogen deaminase (EC 2.5.1.61)
hemD
 
Psychromonas ingrahamii 37

Gene: Ping_3641: Uroporphyrinogen-III synthase (EC 4.2.1.75)
 
Psychromonas sp. CNPT3

Gene: PCNPT3_01650: Uroporphyrinogen-III synthase (EC 4.2.1.75)
 
Moritella sp. PE36

Gene: PE36_15759: Uroporphyrinogen-III synthase (EC 4.2.1.75)
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_0468: Uroporphyrinogen-III synthase (EC 4.2.1.75)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_3876: Uroporphyrinogen-III synthase (EC 4.2.1.75)
 
Tolumonas auensis DSM 9187

Gene: Tola_3128: Uroporphyrinogen-III synthase (EC 4.2.1.75)
Uroporphyrinogen-III synthase (EC 4.2.1.75)
hemX
 
Psychromonas ingrahamii 37

Gene: Ping_3640: uroporphyrin-III C-methyltransferase HemX
 
Psychromonas sp. CNPT3

Gene: PCNPT3_01655: uroporphyrin-III C-methyltransferase HemX
 
Moritella sp. PE36

Gene: PE36_15754: uroporphyrin-III C-methyltransferase HemX
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_0467: uroporphyrin-III C-methyltransferase HemX
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_3877: uroporphyrin-III C-methyltransferase HemX
 
Tolumonas auensis DSM 9187

Gene: Tola_3129: uroporphyrin-III C-methyltransferase HemX
uroporphyrin-III C-methyltransferase HemX
hemY
 
Psychromonas ingrahamii 37

Gene: Ping_3639: HemY protein
 
Psychromonas sp. CNPT3

Gene: PCNPT3_01660: HemY protein
 
Moritella sp. PE36

Gene: PE36_15749: HemY protein
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_0466: HemY protein
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_3878: HemY protein
 
Tolumonas auensis DSM 9187

Gene: Tola_3130: HemY protein
HemY protein
 
CRON 40.
PCNPT3_00166
 
Psychromonas ingrahamii 37
*
Psychromonas sp. CNPT3

Site:
position = -162
score = 5.37342
sequence = TGGTGATAATGGTTATCATTA

Gene: PCNPT3_00166: TonB system biopolymer transport component
*
Moritella sp. PE36

Site:
position = -106
score = 4.86807
sequence = TAAATACAATGATTCTCATTT

Gene: PE36_07037: TonB system biopolymer transport component
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
TonB system biopolymer transport component
PCNPT3_00171
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3

Gene: PCNPT3_00171: MotA/TolQ/ExbB proton channel family protein
 
Moritella sp. PE36

Gene: PE36_07032: MotA/TolQ/ExbB proton channel family protein
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
MotA/TolQ/ExbB proton channel family protein
exbB2
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3

Gene: PCNPT3_00176: Biopolymer transport protein ExbB
 
Moritella sp. PE36

Gene: PE36_07027: Biopolymer transport protein ExbB
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Biopolymer transport protein ExbB
exbD2
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3

Gene: PCNPT3_00181: Biopolymer transport protein ExbD
 
Moritella sp. PE36

Gene: PE36_07022: Biopolymer transport protein ExbD
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Biopolymer transport protein ExbD
tonB2
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3

Gene: PCNPT3_00186: TonB protein
 
Moritella sp. PE36

Gene: PE36_07017: TonB protein
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
TonB protein
PCNPT3_00191
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3

Gene: PCNPT3_00191: TPR domain protein, putative component of TonB system
 
Moritella sp. PE36

Gene: PE36_07012: TPR domain protein, putative component of TonB system
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
TPR domain protein, putative component of TonB system
 
CRON 41.
Tola_2912
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
*
Tolumonas auensis DSM 9187

Site:
position = -95
score = 5.29473
sequence = AGATGAAAAGGGTTATCAATA

Gene: Tola_2912: ferric uptake regulator family protein
ferric uptake regulator family protein
 
CRON 42.
PE36_21054
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -81
score = 5.28269
sequence = AAATAAGAACGATTCCTATTT

Gene: PE36_21054: TonB-dependent receptor
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
TonB-dependent receptor
 
CRON 43.
PE36_19050
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -88
score = 5.26168
sequence = TAATGGTAATAATTATCAGTA

Gene: PE36_19050: outer membrane ferric siderophore receptor, putative
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
outer membrane ferric siderophore receptor, putative
 
CRON 44.
Ping_1736
 
Psychromonas ingrahamii 37

Gene: Ping_1736: Uncharacterized iron-regulated protein
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_20315: Uncharacterized iron-regulated protein
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -178
score = 4.82069
sequence = TATTGAGAACTGTTATCAAAC

Site:
position = -119
score = 4.70578
sequence = TAAACGGAATCATTCTCATTT

Gene: AHA_0971: Uncharacterized iron-regulated protein
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -177
score = 4.82069
sequence = TATTGAGAACTGTTATCAAAC

Site:
position = -118
score = 5.21701
sequence = TAAAGGGAATCATTCTCATTT

Gene: ASA_3329: Uncharacterized iron-regulated protein
 
Tolumonas auensis DSM 9187
Uncharacterized iron-regulated protein
AHA_0970
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_0970: Isochorismatase (EC 3.3.2.1)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_3330: Isochorismatase (EC 3.3.2.1)
 
Tolumonas auensis DSM 9187
Isochorismatase (EC 3.3.2.1)
AHA_0969
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_0969: hypothetical protein
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_3331: hypothetical protein
 
Tolumonas auensis DSM 9187
hypothetical protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD