Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Fur - Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 142 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Pseudoalteromonas atlantica T6c 31 17
Alteromonas macleodii 'Deep ecotype' 14 10
Glaciecola sp. HTCC2999 6 4
Colwellia psychrerythraea 34H 18 10
Alteromonadales bacterium TW-7 29 16
Pseudoalteromonas haloplanktis TAC125 23 15
Pseudoalteromonas tunicata D2 40 20
Idiomarina baltica OS145 21 10
Idiomarina loihiensis L2TR 29 18
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
MADE_01602
 
Pseudoalteromonas atlantica T6c
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -8
score = 5.98354
sequence = AAATGCTAATGGTTATCATTT

Gene: MADE_01602: hypothetical protein
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
hypothetical protein
fumC
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2056: Fumarate hydratase class II (EC 4.2.1.2)
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01603: Fumarate hydratase class II (EC 4.2.1.2)
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7

Gene: ATW7_16525: Fumarate hydratase class II (EC 4.2.1.2)
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -147
score = 5.61009
sequence = TAATGATAACTATTATCAAAT

Gene: PSHAa0048: Fumarate hydratase class II (EC 4.2.1.2)
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145

Gene: OS145_12574: Fumarate hydratase class II (EC 4.2.1.2)
 
Idiomarina loihiensis L2TR

Gene: IL0937: Fumarate hydratase class II (EC 4.2.1.2)
Fumarate hydratase class II (EC 4.2.1.2)
ATW7_16530
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
*
Alteromonadales bacterium TW-7

Site:
position = -116
score = 6.0493
sequence = TAATGATAACTATTATCATTA

Gene: ATW7_16530: hypothetical protein
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
hypothetical protein
 
CRON 2.
PF11449
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H

Gene: CPS_2709: Predicted manganese transporter, 11 TMS
*
Alteromonadales bacterium TW-7

Site:
position = -68
score = 6.16607
sequence = AAATGATATTGATTATCATTT

Gene: ATW7_13233: Predicted manganese transporter, 11 TMS
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -67
score = 6.16607
sequence = AAATGATATTGATTATCATTT

Gene: PSHAa1629: Predicted manganese transporter, 11 TMS
*
Pseudoalteromonas tunicata D2

Site:
position = -66
score = 6.16607
sequence = AAATGATATTGATTATCATTT

Gene: PTD2_19380: Predicted manganese transporter, 11 TMS
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Predicted manganese transporter, 11 TMS
 
CRON 3.
COG4771
*
Pseudoalteromonas atlantica T6c

Site:
position = -66
score = 5.59969
sequence = AAATGATAACGATTACTATTT

Gene: Patl_1486: Outer membrane receptor for ferrienterochelin, TonB-dependent
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -33
score = 4.77727
sequence = AAATCATTATCATTTGCATTA

Site:
position = -39
score = 5.56568
sequence = AAACGCAAATCATTATCATTT

Gene: MADE_01534: Outer membrane receptor for ferrienterochelin, TonB-dependent
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Outer membrane receptor for ferrienterochelin, TonB-dependent
Patl_1487
 
Pseudoalteromonas atlantica T6c

Gene: Patl_1487: hypothetical protein
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01535: hypothetical protein
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
hypothetical protein
hmuT
 
Pseudoalteromonas atlantica T6c

Gene: Patl_1488: Hemin ABC transporter, periplasmic component
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01536: Hemin ABC transporter, periplasmic component
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAb0068: Hemin ABC transporter, periplasmic component
*
Pseudoalteromonas tunicata D2

Site:
position = -76
score = 5.94187
sequence = TAATGAGAAGTATTATCATTT

Gene: PTD2_10203: Hemin ABC transporter, periplasmic component
*
Idiomarina baltica OS145

Site:
position = -81
score = 5.39068
sequence = AAACGAAAACTATTTGCATTT

Gene: OS145_06449: Hemin ABC transporter, periplasmic component
*
Idiomarina loihiensis L2TR

Site:
position = -87
score = 5.53221
sequence = AAACGAAAATGATTTGCATTT

Gene: IL0113: Hemin ABC transporter, periplasmic component
Hemin ABC transporter, periplasmic component
hmuU
 
Pseudoalteromonas atlantica T6c

Gene: Patl_1489: Hemin ABC transporter, permease protein
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01537: Hemin ABC transporter, permease protein
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAb0067: Hemin ABC transporter, permease protein
 
Pseudoalteromonas tunicata D2

Gene: PTD2_10198: Hemin ABC transporter, permease protein
 
Idiomarina baltica OS145

Gene: OS145_06454: Hemin ABC transporter, permease protein
 
Idiomarina loihiensis L2TR

Gene: IL0114: Hemin ABC transporter, permease protein
Hemin ABC transporter, permease protein
hmuV
 
Pseudoalteromonas atlantica T6c

Gene: Patl_1490: Hemin ABC transporter, ATP-binding protein
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01538: Hemin ABC transporter, ATP-binding protein
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAb0066: Hemin ABC transporter, ATP-binding protein
 
Pseudoalteromonas tunicata D2

Gene: PTD2_10193: Hemin ABC transporter, ATP-binding protein
 
Idiomarina baltica OS145

Gene: OS145_06459: Hemin ABC transporter, ATP-binding protein
 
Idiomarina loihiensis L2TR

Gene: IL0115: Hemin ABC transporter, ATP-binding protein
Hemin ABC transporter, ATP-binding protein
COG0748
 
Pseudoalteromonas atlantica T6c

Gene: Patl_1491: Putative heme iron utilization protein
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01539: Putative heme iron utilization protein
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145

Gene: OS145_06464: Putative heme iron utilization protein
 
Idiomarina loihiensis L2TR

Gene: IL0116: Putative heme iron utilization protein
Putative heme iron utilization protein
 
CRON 4.
Patl_2402
*
Pseudoalteromonas atlantica T6c

Site:
position = -27
score = 5.99733
sequence = AAATGATAATAATTAGCATTA

Gene: Patl_2402: Ferric aerobactin receptor
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
*
Colwellia psychrerythraea 34H

Site:
position = -66
score = 5.90853
sequence = AAATAATAACAATTATCATTA

Gene: CPS_4213: Ferric aerobactin receptor
 
Alteromonadales bacterium TW-7
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -49
score = 5.1953
sequence = TATTGTTAATAGTTATCATTA

Gene: PSHAb0286: Ferric aerobactin receptor
*
Pseudoalteromonas tunicata D2

Site:
position = -23
score = 5.87506
sequence = AAATAAAAACAATTATCATTA

Gene: PTD2_01521: Ferric aerobactin receptor
*
Idiomarina baltica OS145

Site:
position = -52
score = 5.95517
sequence = TAATGAGAACAATTATCATCT

Site:
position = -17
score = 5.46783
sequence = AAATGATAAGGATTCTCATGT

Gene: OS145_03090: Ferric aerobactin receptor
 
Idiomarina loihiensis L2TR
Ferric aerobactin receptor
pepSY
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2403: Uncharacterized iron-regulated membrane protein; Iron-uptake factor PiuB
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -149
score = 5.14722
sequence = AATTGAAAACTGCTCTCATTA

Gene: PSHAb0287: Uncharacterized iron-regulated membrane protein; Iron-uptake factor PiuB
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145

Gene: OS145_03095: Uncharacterized iron-regulated membrane protein; Iron-uptake factor PiuB
 
Idiomarina loihiensis L2TR
Uncharacterized iron-regulated membrane protein; Iron-uptake factor PiuB
 
CRON 5.
COG4774
*
Pseudoalteromonas atlantica T6c

Site:
position = -59
score = 5.32186
sequence = AAATGATATTAATTACCATTC

Gene: Patl_3803: Outer membrane receptor for monomeric catechols, TonB-dependent
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
*
Colwellia psychrerythraea 34H

Site:
position = -62
score = 5.97483
sequence = TATTGATAATCATTATCATTA

Site:
position = -296
score = 4.7436
sequence = AAATGAAAAATATTATAAAAA

Gene: CPS_1347: Outer membrane receptor for monomeric catechols, TonB-dependent
*
Alteromonadales bacterium TW-7

Site:
position = -20
score = 5.43922
sequence = AAATGCGAATGGTTATCATAA

Site:
position = -59
score = 4.55243
sequence = TTTTGCAAATAATAATCATTA

Site:
position = -53
score = 5.59969
sequence = AAATAATAATCATTACCATTA

Gene: ATW7_00380: Outer membrane receptor for monomeric catechols, TonB-dependent
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -22
score = 4.83279
sequence = AAATACGAATACTTACCATTA

Site:
position = -55
score = 5.24349
sequence = TAACGATAACCATTATCATTC

Gene: PSHAb0512: Outer membrane receptor for monomeric catechols, TonB-dependent
*
Pseudoalteromonas tunicata D2

Site:
position = -47
score = 5.61508
sequence = AACTGATAATTATTATCATTC

Site:
position = -92
score = 5.01616
sequence = AAATAATAATTATTCGTATAA

Gene: PTD2_20667: Outer membrane receptor for monomeric catechols, TonB-dependent
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Outer membrane receptor for monomeric catechols, TonB-dependent
ATW7_00890
 
Pseudoalteromonas atlantica T6c

Gene: Patl_3802: iron uptake protein
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
*
Colwellia psychrerythraea 34H

Site:
position = -148
score = 6.01659
sequence = AAATGATAATGGTTTTTATTT

Gene: CPS_0262: iron uptake protein
*
Alteromonadales bacterium TW-7

Site:
position = -87
score = 5.191
sequence = AAATGAGAATCACTATCTTTT

Gene: ATW7_00890: iron uptake protein
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAb0042: iron uptake protein
*
Pseudoalteromonas tunicata D2

Site:
position = -83
score = 5.2048
sequence = AAATGAGAATTACTATCTTTT

Gene: PTD2_01631: iron uptake protein
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
iron uptake protein
pepSY
 
Pseudoalteromonas atlantica T6c

Gene: Patl_3801: iron-regulated membrane protein
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H

Gene: CPS_0263: iron-regulated membrane protein
 
Alteromonadales bacterium TW-7

Gene: ATW7_00895: iron-regulated membrane protein
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAb0043: iron-regulated membrane protein
 
Pseudoalteromonas tunicata D2

Gene: PTD2_01626: iron-regulated membrane protein
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
iron-regulated membrane protein
ATW7_00900
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H

Gene: CPS_0264: iron uptake protein
 
Alteromonadales bacterium TW-7

Gene: ATW7_00900: iron uptake protein
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2

Gene: PTD2_01621: iron uptake protein
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
iron uptake protein
 
CRON 6.
CPS_0694
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H

Gene: CPS_0694: Iron-regulated protein A precursor
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
*
Pseudoalteromonas tunicata D2

Site:
position = -29
score = 5.87332
sequence = AAATAAGATTTATTATCATTT

Site:
position = -85
score = 6.02454
sequence = AAATGATATTTATTATCATTA

Gene: PTD2_09069: Iron-regulated protein A precursor
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Iron-regulated protein A precursor
CPS_0695
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H

Gene: CPS_0695: Probable thiol oxidoreductase with 2 cytochrome c heme-binding sites
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2

Gene: PTD2_09074: Probable thiol oxidoreductase with 2 cytochrome c heme-binding sites
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Probable thiol oxidoreductase with 2 cytochrome c heme-binding sites
PTD2_09079
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2

Gene: PTD2_09079: Probable thiol oxidoreductase with 2 cytochrome c heme-binding sites
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Probable thiol oxidoreductase with 2 cytochrome c heme-binding sites
irpA
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 2
Pseudoalteromonas tunicata D2

Gene: PTD2_15702: Iron-regulated protein A precursor

Gene: PTD2_09084: Iron-regulated protein A precursor
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Iron-regulated protein A precursor
PTD2_15697
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
*
Pseudoalteromonas tunicata D2

Site:
position = -82
score = 5.52319
sequence = TAATGAGATTGATTATCATTG

Site:
position = -158
score = 4.82328
sequence = AAATAAAAATAATACTTATCA

Site:
position = -155
score = 4.61983
sequence = TAAAAATAATACTTATCATAT

Gene: PTD2_15697: VCBS
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
VCBS
fecA
*
Pseudoalteromonas atlantica T6c

Site:
position = -105
score = 5.43722
sequence = TATTGATAATAGTTTGCATTA

Gene: Patl_3109: TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_02035: TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins
*
Glaciecola sp. HTCC2999

Site:
position = -85
score = 5.92917
sequence = AATTGAGATTGATTCTCATTT

Gene: GHTCC_010100005799: TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins
 
Colwellia psychrerythraea 34H
*
Alteromonadales bacterium TW-7

Site:
position = -74
score = 4.93397
sequence = TAATAATATTGATTCGCATTC

Gene: ATW7_03447: TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -78
score = 4.74573
sequence = GAATAACATTGATTCTCATTC

Gene: PSHAa2478: TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins
 
Pseudoalteromonas tunicata D2

Gene: PTD2_15707: TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins
*
Idiomarina baltica OS145

Site:
position = -64
score = 5.25706
sequence = AATTGCGAATTATTCGTATTT

Gene: OS145_08648: TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins
*
Idiomarina loihiensis L2TR

Site:
position = -88
score = 5.45055
sequence = TATTGCGAATCATTCTTATTT

Gene: IL2393: TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins
TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins
 
CRON 7.
bfd
*
Pseudoalteromonas atlantica T6c

Site:
position = -46
score = 5.38093
sequence = AAACAACAATTATTATCATTT

Gene: Patl_1397: Bacterioferritin-associated ferredoxin
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -57
score = 5.06263
sequence = GAATAGCAATTATTATCATTT

Gene: MADE_02744: Bacterioferritin-associated ferredoxin
*
Glaciecola sp. HTCC2999

Site:
position = -46
score = 5.89808
sequence = AAATGAGAACTATTATTATTA

Gene: GHTCC_010100007522: Bacterioferritin-associated ferredoxin
*2
Colwellia psychrerythraea 34H

Site:
position = -76
score = 5.8333
sequence = TATTGATAATTGTTATCATTA

Gene: CPS_1169: Bacterioferritin-associated ferredoxin

Gene: CPS_1311: Bacterioferritin-associated ferredoxin
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
*
Idiomarina baltica OS145

Site:
position = -136
score = 5.17397
sequence = TGTTGAAAATCGTTCGCATTA

Gene: OS145_11871: Bacterioferritin-associated ferredoxin
*
Idiomarina loihiensis L2TR

Site:
position = -57
score = 5.20568
sequence = TATTGCAAATCGTTCGCATTT

Gene: IL1065: Bacterioferritin-associated ferredoxin
Bacterioferritin-associated ferredoxin
bfr2
*
Pseudoalteromonas atlantica T6c

Site:
position = -147
score = 4.51648
sequence = AATCATCAATTATTCTCATTT

Gene: Patl_2076: Bacterioferritin, subunit 2
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100006129: Bacterioferritin, subunit 2
 
Colwellia psychrerythraea 34H

Gene: CPS_1168: Bacterioferritin, subunit 2
 
Alteromonadales bacterium TW-7

Gene: ATW7_02492: Bacterioferritin, subunit 2
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAb0283: Bacterioferritin, subunit 2
*
Pseudoalteromonas tunicata D2

Site:
position = -157
score = 4.91838
sequence = AAATAACAATAATTGTTATTC

Gene: PTD2_02826: Bacterioferritin, subunit 2
 
Idiomarina baltica OS145

Gene: OS145_11876: Bacterioferritin, subunit 2
 
Idiomarina loihiensis L2TR

Gene: IL1066: Bacterioferritin, subunit 2
Bacterioferritin, subunit 2
bfr1
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2075: Bacterioferritin subunit 1
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_02052: Bacterioferritin subunit 1
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100006124: Bacterioferritin subunit 1
*
Colwellia psychrerythraea 34H

Site:
position = -155
score = 4.62579
sequence = TAATGAAAATACAAATTATTT

Site:
position = -149
score = 5.36654
sequence = AAATACAAATTATTTTCACTT

Gene: CPS_1167: Bacterioferritin subunit 1
 
Alteromonadales bacterium TW-7

Gene: ATW7_02497: Bacterioferritin subunit 1
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAb0284: Bacterioferritin subunit 1
 
Pseudoalteromonas tunicata D2

Gene: PTD2_02821: Bacterioferritin subunit 1
 
Idiomarina baltica OS145

Gene: OS145_11881: Bacterioferritin subunit 1
 
Idiomarina loihiensis L2TR

Gene: IL1067: Bacterioferritin subunit 1
Bacterioferritin subunit 1
 
CRON 8.
CPS_1855
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
*
Colwellia psychrerythraea 34H

Site:
position = -155
score = 5.06485
sequence = AAATGTAAATTGTTATCAATC

Gene: CPS_1855: conserved protein of unknown function; putative membrane-associated protein
*
Alteromonadales bacterium TW-7

Site:
position = -48
score = 5.33449
sequence = TAATGCAAATCATTATCATGT

Gene: ATW7_15879: conserved protein of unknown function; putative membrane-associated protein
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -49
score = 5.03841
sequence = TAATACAAATCATTATCATGT

Gene: PSHAa2970: conserved protein of unknown function; putative membrane-associated protein
*
Pseudoalteromonas tunicata D2

Site:
position = -162
score = 5.83407
sequence = AAATAATAACCATTATCAATT

Gene: PTD2_16666: conserved protein of unknown function; putative membrane-associated protein
 
Idiomarina baltica OS145

Gene: OS145_04638: conserved protein of unknown function; putative membrane-associated protein
*
Idiomarina loihiensis L2TR

Site:
position = -89
score = 5.87239
sequence = AAATGAGAATTTTTATCATTA

Site:
position = -60
score = 5.47227
sequence = AAATGAGAACGGTTTTTATAT

Gene: IL2502: conserved protein of unknown function; putative membrane-associated protein
conserved protein of unknown function; putative membrane-associated protein
CPS_1856
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H

Gene: CPS_1856: putative exported protein
 
Alteromonadales bacterium TW-7

Gene: ATW7_15884: putative exported protein
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa2971: putative exported protein
 
Pseudoalteromonas tunicata D2

Gene: PTD2_16671: putative exported protein
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
putative exported protein
ATW7_15889
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7

Gene: ATW7_15889: Uncharacterized metal-binding protein
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa2972: Uncharacterized metal-binding protein
 
Pseudoalteromonas tunicata D2

Gene: PTD2_16676: Uncharacterized metal-binding protein
 
Idiomarina baltica OS145

Gene: OS145_04643: Uncharacterized metal-binding protein
 
Idiomarina loihiensis L2TR

Gene: IL2503: Uncharacterized metal-binding protein
Uncharacterized metal-binding protein
irgA
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -47
score = 5.92287
sequence = AAATGCTAATCATTATCAATT

Gene: PSHAb0251: TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins
 
Pseudoalteromonas tunicata D2
*
Idiomarina baltica OS145

Site:
position = -39
score = 6.01994
sequence = AAATAAAAACTATTCTCATTT

Gene: OS145_04633: TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins
*
Idiomarina loihiensis L2TR

Site:
position = -42
score = 5.95341
sequence = TAATGAAAATAATTCGCATTT

Gene: IL2490: TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins
TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins
 
CRON 9.
fhuE
*
Pseudoalteromonas atlantica T6c

Site:
position = -97
score = 5.17769
sequence = GAATGCAAATAGTTATCATAT

Gene: Patl_0311: TonB-dependent siderophore receptor
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -102
score = 5.47026
sequence = AAATAGCAATAATTATCATTT

Gene: MADE_00133: TonB-dependent siderophore receptor
 
Glaciecola sp. HTCC2999
*
Colwellia psychrerythraea 34H

Site:
position = -85
score = 5.14774
sequence = TAACGATAATGATTAGTATTT

Site:
position = -79
score = 4.89467
sequence = TAATGATTAGTATTTGCATTT

Gene: CPS_2724: TonB-dependent siderophore receptor
 
Alteromonadales bacterium TW-7
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -65
score = 5.55399
sequence = AATTGCAAATCAATATCATTT

Gene: PSHAa0695: TonB-dependent siderophore receptor
*
Pseudoalteromonas tunicata D2

Site:
position = -66
score = 6.29928
sequence = AATTGATAATAATTATCATTT

Gene: PTD2_04291: TonB-dependent siderophore receptor
*
Idiomarina baltica OS145

Site:
position = -190
score = 5.02585
sequence = AAATAAGAATGATTATGTTTT

Site:
position = -184
score = 4.92171
sequence = GAATGATTATGTTTTTCATTT

Site:
position = -162
score = 5.73994
sequence = AGTTGATAATCATTCTTATTT

Site:
position = -63
score = 5.3999
sequence = AAACGCGAATCGTTTTCATTT

Gene: OS145_01627: TonB-dependent siderophore receptor
 
Idiomarina loihiensis L2TR
TonB-dependent siderophore receptor
pepSY
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H

Gene: CPS_2723: putative iron-regulated membrane protein
*
Alteromonadales bacterium TW-7

Site:
position = -51
score = 5.42991
sequence = AAATAACAATTGATATCATTT

Gene: ATW7_15829: putative iron-regulated membrane protein
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -52
score = 5.12076
sequence = AATTGATAATTGTTATCATGC

Gene: PSHAa2961: putative iron-regulated membrane protein
 
Pseudoalteromonas tunicata D2

Gene: PTD2_04296: putative iron-regulated membrane protein
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
putative iron-regulated membrane protein
 
CRON 10.
MADE_00161
 
Pseudoalteromonas atlantica T6c
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = 5
score = 5.71778
sequence = TAATGATAATAAGTATCATTT

Gene: MADE_00161: putative orphan protein
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
*
Alteromonadales bacterium TW-7

Site:
position = -48
score = 5.00366
sequence = ATATGATAATGTCTATCATTT

Gene: ATW7_13138: putative orphan protein
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -45
score = 5.08694
sequence = ATATGATAATACCTATCATTT

Gene: PSHAa1611: putative orphan protein
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
putative orphan protein
fbpA
*
Pseudoalteromonas atlantica T6c

Site:
position = -32
score = 6.07283
sequence = AATTGATAATTATTCTCAATT

Gene: Patl_1596: Ferric iron ABC transporter, iron-binding protein
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_00162: Ferric iron ABC transporter, iron-binding protein
*
Glaciecola sp. HTCC2999

Site:
position = -61
score = 5.75173
sequence = TATTGAGAATTATTCTCAATA

Gene: GHTCC_010100005814: Ferric iron ABC transporter, iron-binding protein
*
Colwellia psychrerythraea 34H

Site:
position = -86
score = 4.64584
sequence = TAATGAGAGTGATTCGTATAT

Gene: CPS_1012: Ferric iron ABC transporter, iron-binding protein
*2
Alteromonadales bacterium TW-7

Site:
position = -31
score = 5.39749
sequence = TATTGATAATAATTACTATTT

Gene: ATW7_12358: Ferric iron ABC transporter, iron-binding protein

Gene: ATW7_13143: Ferric iron ABC transporter, iron-binding protein
*2
Pseudoalteromonas haloplanktis TAC125

Site:
position = -32
score = 5.28491
sequence = TATTGATAATAGTTATTATTC

Gene: PSHAa2663: Ferric iron ABC transporter, iron-binding protein

Gene: PSHAa1612: Ferric iron ABC transporter, iron-binding protein
*
Pseudoalteromonas tunicata D2

Site:
position = -33
score = 5.6142
sequence = ATTTGATAATAATTCTTATTT

Gene: PTD2_08484: Ferric iron ABC transporter, iron-binding protein
*
Idiomarina baltica OS145

Site:
position = -83
score = 5.53821
sequence = AAATGAGAATGGCTATCATTA

Gene: OS145_11901: Ferric iron ABC transporter, iron-binding protein
*
Idiomarina loihiensis L2TR

Site:
position = -84
score = 5.53821
sequence = AAATGAGAATGGCTATCATTA

Gene: IL1059: Ferric iron ABC transporter, iron-binding protein
Ferric iron ABC transporter, iron-binding protein
fbpB
 
Pseudoalteromonas atlantica T6c

Gene: Patl_1597: Ferric iron ABC transporter, permease protein
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_00163: Ferric iron ABC transporter, permease protein
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100005809: Ferric iron ABC transporter, permease protein
 
Colwellia psychrerythraea 34H

Gene: CPS_1013: Ferric iron ABC transporter, permease protein
 2
Alteromonadales bacterium TW-7

Gene: ATW7_12353: Ferric iron ABC transporter, permease protein

Gene: ATW7_13148: Ferric iron ABC transporter, permease protein
 2
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa2662: Ferric iron ABC transporter, permease protein

Gene: PSHAa1613: Ferric iron ABC transporter, permease protein
 
Pseudoalteromonas tunicata D2

Gene: PTD2_08489: Ferric iron ABC transporter, permease protein
 
Idiomarina baltica OS145

Gene: OS145_11896: Ferric iron ABC transporter, permease protein
 
Idiomarina loihiensis L2TR

Gene: IL1060: Ferric iron ABC transporter, permease protein
Ferric iron ABC transporter, permease protein
fbpC
 
Pseudoalteromonas atlantica T6c

Gene: Patl_1598: Ferric iron ABC transporter, ATP-binding protein
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_00164: Ferric iron ABC transporter, ATP-binding protein
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100005804: Ferric iron ABC transporter, ATP-binding protein
 
Colwellia psychrerythraea 34H

Gene: CPS_1014: Ferric iron ABC transporter, ATP-binding protein
 2
Alteromonadales bacterium TW-7

Gene: ATW7_12348: Ferric iron ABC transporter, ATP-binding protein

Gene: ATW7_13153: Ferric iron ABC transporter, ATP-binding protein
 2
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa2661: Ferric iron ABC transporter, ATP-binding protein

Gene: PSHAa1614: Ferric iron ABC transporter, ATP-binding protein
 
Pseudoalteromonas tunicata D2

Gene: PTD2_08494: Ferric iron ABC transporter, ATP-binding protein
 
Idiomarina baltica OS145

Gene: OS145_11891: Ferric iron ABC transporter, ATP-binding protein
 
Idiomarina loihiensis L2TR

Gene: IL1061: Ferric iron ABC transporter, ATP-binding protein
Ferric iron ABC transporter, ATP-binding protein
yfeK
*
Pseudoalteromonas atlantica T6c

Site:
position = -260
score = 4.57443
sequence = TAATAATAACAATACTCACCT

Gene: Patl_0493: Predicted iron-dependent peroxidase, Dyp-type family
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_00482: Predicted iron-dependent peroxidase, Dyp-type family
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100001919: Predicted iron-dependent peroxidase, Dyp-type family
 
Colwellia psychrerythraea 34H

Gene: CPS_4479: Predicted iron-dependent peroxidase, Dyp-type family
 
Alteromonadales bacterium TW-7

Gene: ATW7_12343: Predicted iron-dependent peroxidase, Dyp-type family
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa2660: Predicted iron-dependent peroxidase, Dyp-type family
 
Pseudoalteromonas tunicata D2

Gene: PTD2_08499: Predicted iron-dependent peroxidase, Dyp-type family
 
Idiomarina baltica OS145

Gene: OS145_05020: Predicted iron-dependent peroxidase, Dyp-type family
 
Idiomarina loihiensis L2TR

Gene: IL0470: Predicted iron-dependent peroxidase, Dyp-type family
Predicted iron-dependent peroxidase, Dyp-type family
 
CRON 11.
fpr
*
Pseudoalteromonas atlantica T6c

Site:
position = -70
score = 4.98516
sequence = AAATAAGAATTATTACTATTG

Gene: Patl_2287: Ferredoxin--NADP(+) reductase (EC 1.18.1.2)
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
*
Idiomarina baltica OS145

Site:
position = -103
score = 5.41781
sequence = ATATGCGATTTATTCTCATTT

Site:
position = -74
score = 5.99424
sequence = AAATGAAAAAAATTCTCATTT

Gene: OS145_09243: Ferredoxin--NADP(+) reductase (EC 1.18.1.2)
*
Idiomarina loihiensis L2TR

Site:
position = -104
score = 5.47227
sequence = ATATAAAAACCGTTCTCATTT

Site:
position = -75
score = 5.87239
sequence = TAATGATAAAAATTCTCATTT

Gene: IL2501: Ferredoxin--NADP(+) reductase (EC 1.18.1.2)
Ferredoxin--NADP(+) reductase (EC 1.18.1.2)
 
CRON 12.
CPS_3425
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
*
Colwellia psychrerythraea 34H

Site:
position = -104
score = 5.89577
sequence = AAATGATAATGATTACCATTA

Gene: CPS_3425: Ferrichrome-iron receptor
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Ferrichrome-iron receptor
piuC
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H

Gene: CPS_3426: Iron-uptake factor PiuC
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
*
Idiomarina baltica OS145

Site:
position = -39
score = 5.39235
sequence = AAATGATAACTATTCGCAAAT

Gene: OS145_07332: Iron-uptake factor PiuC
*
Idiomarina loihiensis L2TR

Site:
position = -36
score = 5.15531
sequence = AAATGATAACTATTCGCAAGT

Gene: IL0759: Iron-uptake factor PiuC
Iron-uptake factor PiuC
 
CRON 13.
ahpCB
*
Pseudoalteromonas atlantica T6c

Site:
position = -241
score = 5.38093
sequence = AAATGATAATAATTGTTGTTT

Gene: Patl_1398: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-)
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -251
score = 5.06263
sequence = AAATGATAATAATTGCTATTC

Gene: MADE_02743: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-)
*
Glaciecola sp. HTCC2999

Site:
position = -171
score = 5.89808
sequence = TAATAATAATAGTTCTCATTT

Gene: GHTCC_010100007527: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-)
 
Colwellia psychrerythraea 34H

Gene: CPS_3474: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-)
 
Alteromonadales bacterium TW-7

Gene: ATW7_09746: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-)
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa0839: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-)
 
Pseudoalteromonas tunicata D2

Gene: PTD2_15612: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-)
 2
Idiomarina baltica OS145

Gene: OS145_09500: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-)

Gene: OS145_10326: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-)
 2
Idiomarina loihiensis L2TR

Gene: IL2576: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-)

Gene: IL1803: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-)
Alkyl hydroperoxide reductase protein C (EC 1.6.4.-)
 
CRON 14.
ftr1
*
Pseudoalteromonas atlantica T6c

Site:
position = -41
score = 6.20873
sequence = AAATAATAATTATTCTCATTT

Gene: Patl_1058: High-affinity Fe2+/Pb2+ permease
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
*
Idiomarina loihiensis L2TR

Site:
position = -85
score = 5.2256
sequence = AAACAACAATAGTTATCATTT

Gene: IL0111: High-affinity Fe2+/Pb2+ permease
High-affinity Fe2+/Pb2+ permease
 
CRON 15.
COG3205
*
Pseudoalteromonas atlantica T6c

Site:
position = -139
score = 5.34493
sequence = AAATGAGAATTAATCGTATTA

Gene: Patl_0749: membrane protein
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -65
score = 6.1335
sequence = AATTGATAATAATTCTCATTA

Gene: MADE_02392: membrane protein
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
membrane protein
 
CRON 16.
Patl_1142
*
Pseudoalteromonas atlantica T6c

Site:
position = -72
score = 6.08624
sequence = AATTGAAAATCATTCTCATTA

Gene: Patl_1142: TonB-dependent siderophore receptor
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
*
Alteromonadales bacterium TW-7

Site:
position = -54
score = 5.54866
sequence = TAATGATAGTCGTTATCATTT

Gene: ATW7_09161: TonB-dependent siderophore receptor
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -56
score = 4.9233
sequence = AAATGAGAGTGGTTAGCATTC

Gene: PSHAb0279: TonB-dependent siderophore receptor
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
TonB-dependent siderophore receptor
Patl_1143
 
Pseudoalteromonas atlantica T6c

Gene: Patl_1143: putative iron-regulated membrane protein
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
putative iron-regulated membrane protein
 
CRON 17.
bfd
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
*
Alteromonadales bacterium TW-7

Site:
position = -66
score = 5.24216
sequence = TATTGATAACTATTACTATTT

Gene: ATW7_02487: Bacterioferritin-associated ferredoxin
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAb0282: Bacterioferritin-associated ferredoxin
*
Pseudoalteromonas tunicata D2

Site:
position = -64
score = 5.79814
sequence = TATTGAAAATGATTGTCATTT

Gene: PTD2_08349: Bacterioferritin-associated ferredoxin
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Bacterioferritin-associated ferredoxin
 
CRON 18.
Patl_0871
*2
Pseudoalteromonas atlantica T6c

Site:
position = -83
score = 5.75835
sequence = AAATAGTAATAATTCTCATTT

Gene: Patl_2259: Siderophore-interacting protein

Gene: Patl_0871: Siderophore-interacting protein
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -53
score = 5.10316
sequence = TAATGAGAATCATTAACAAAT

Gene: MADE_03816: Siderophore-interacting protein
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7

Gene: ATW7_00540: Siderophore-interacting protein
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAb0539: Siderophore-interacting protein
 
Pseudoalteromonas tunicata D2

Gene: PTD2_22232: Siderophore-interacting protein
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Siderophore-interacting protein
 
CRON 19.
CPS_4959
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H

Gene: CPS_4959: Ferrichrome-iron receptor
*
Alteromonadales bacterium TW-7

Site:
position = -67
score = 5.69498
sequence = AAATGATATTTATTTTTATTA

Gene: ATW7_15529: Ferrichrome-iron receptor
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -62
score = 5.51519
sequence = AAATGATACTGGTTTTCATTA

Gene: PSHAa0108: Ferrichrome-iron receptor
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Ferrichrome-iron receptor
 
CRON 20.
OS145_11766
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
*
Idiomarina baltica OS145

Site:
position = -63
score = 5.30355
sequence = ATTTGATAATTGTTCTTATTA

Gene: OS145_11766: putative iron-regulated membrane protein
*
Idiomarina loihiensis L2TR

Site:
position = -58
score = 5.09626
sequence = ATTTGATAATTGTTCGTATTT

Site:
position = -85
score = 5.36611
sequence = AAATGAGAATTGTTCGCAACA

Gene: IL2512: putative iron-regulated membrane protein
putative iron-regulated membrane protein
OS145_11761
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145

Gene: OS145_11761: hypothetical protein
 
Idiomarina loihiensis L2TR

Gene: IL2513: hypothetical protein
hypothetical protein
 
CRON 21.
IL1578
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
*
Idiomarina loihiensis L2TR

Site:
position = -105
score = 6.15736
sequence = AAATGATAATGGTTTTCATTA

Gene: IL1578: putative iron-regulated membrane protein
putative iron-regulated membrane protein
 
CRON 22.
Patl_1817
 
Pseudoalteromonas atlantica T6c

Gene: Patl_1817: Uncharacterized protein conserved in bacteria
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -72
score = 4.79506
sequence = AAGTATAAATTATTTTTATTT

Gene: MADE_02492: Uncharacterized protein conserved in bacteria
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H

Gene: CPS_2824: Uncharacterized protein conserved in bacteria
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2

Gene: PTD2_01891: Uncharacterized protein conserved in bacteria
 
Idiomarina baltica OS145

Gene: OS145_01642: Uncharacterized protein conserved in bacteria
*
Idiomarina loihiensis L2TR

Site:
position = -59
score = 6.15736
sequence = TAATGAAAACCATTATCATTT

Gene: IL1577: Uncharacterized protein conserved in bacteria
Uncharacterized protein conserved in bacteria
MADE_01572
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01572: TonB-dependent receptor, putative
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7

Gene: ATW7_12708: TonB-dependent receptor, putative
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145

Gene: OS145_05835: TonB-dependent receptor, putative
 
Idiomarina loihiensis L2TR

Gene: IL1576: TonB-dependent receptor, putative
TonB-dependent receptor, putative
 
CRON 23.
PTD2_00731
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
*
Pseudoalteromonas tunicata D2

Site:
position = -43
score = 6.02454
sequence = AAATGATAATTGATATCATTT

Gene: PTD2_00731: Iron-regulated outer membrane protein
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Iron-regulated outer membrane protein
 
CRON 24.
Patl_1443
*
Pseudoalteromonas atlantica T6c

Site:
position = -93
score = 4.7438
sequence = AAATTCAAATGATATTCATTA

Site:
position = -87
score = 6.01075
sequence = AAATGATATTCATTATCATTA

Gene: Patl_1443: Ferrichrome-iron receptor
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Ferrichrome-iron receptor
Patl_1444
 
Pseudoalteromonas atlantica T6c

Gene: Patl_1444: putative iron-regulated membrane protein
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
putative iron-regulated membrane protein
 
CRON 25.
IL0795
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
*
Idiomarina loihiensis L2TR

Site:
position = -67
score = 5.98863
sequence = AATTGATAATAGTTATCATTA

Gene: IL0795: Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid
Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid
 
CRON 26.
hmuR
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAb0072: TonB-dependent hemin , ferrichrome receptor
*
Pseudoalteromonas tunicata D2

Site:
position = -94
score = 5.94187
sequence = AAATGATAATACTTCTCATTA

Gene: PTD2_10208: TonB-dependent hemin , ferrichrome receptor
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
TonB-dependent hemin , ferrichrome receptor
hmuS
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAb0073: Hemin transport protein HmuS
 
Pseudoalteromonas tunicata D2

Gene: PTD2_10213: Hemin transport protein HmuS
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Hemin transport protein HmuS
 
CRON 27.
PTD2_00706
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
*
Pseudoalteromonas tunicata D2

Site:
position = -128
score = 5.90957
sequence = AAATGATAACAATTACCATTT

Gene: PTD2_00706: Vibriobactin receptor precursor
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Vibriobactin receptor precursor
 
CRON 28.
piu
*
Pseudoalteromonas atlantica T6c

Site:
position = -51
score = 5.62153
sequence = TAATGAGAATGCTTCTTATTT

Gene: Patl_3414: Putaive Fe-regulated protein B
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
*
Idiomarina loihiensis L2TR

Site:
position = -52
score = 4.70636
sequence = ACAATATAATCATTCTCATTT

Gene: IL0069: Putaive Fe-regulated protein B
Putaive Fe-regulated protein B
piuB
 
Pseudoalteromonas atlantica T6c

Gene: Patl_3413: Uncharacterized iron-regulated membrane protein; Iron-uptake factor PiuB
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H

Gene: CPS_4883: Uncharacterized iron-regulated membrane protein; Iron-uptake factor PiuB
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Uncharacterized iron-regulated membrane protein; Iron-uptake factor PiuB
 
CRON 29.
PTD2_05935
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
*
Pseudoalteromonas tunicata D2

Site:
position = -2
score = 5.55282
sequence = AAATGATAACGATTAACATTA

Gene: PTD2_05935: Ferrichrome-iron receptor
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Ferrichrome-iron receptor
PTD2_05930
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2

Gene: PTD2_05930: Iron-uptake factor PiuC
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Iron-uptake factor PiuC
 
CRON 30.
ATW7_05436
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
*
Alteromonadales bacterium TW-7

Site:
position = -89
score = 4.75429
sequence = AAATAATAACAACTATTAATA

Gene: ATW7_05436: putative orphan protein; putative conserved domain
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -34
score = 4.75845
sequence = TAATAATAATTATTAATAATA

Site:
position = -37
score = 5.55178
sequence = AAATAATAATAATTATTAATA

Gene: PSHAa0951: diguanylate cyclase/phosphodiesterase (GGDEF & EAL domains) with PAS/PAC sensor(s)
 
Pseudoalteromonas tunicata D2

Gene: PTD2_15542: diguanylate cyclase/phosphodiesterase (GGDEF & EAL domains) with PAS/PAC sensor(s)
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
putative orphan protein; putative conserved domain
 
CRON 31.
IL0109
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
*
Idiomarina loihiensis L2TR

Site:
position = -177
score = 5.47754
sequence = TATTGATACTGATTCTCATTT

Gene: IL0109: Probable TonB-dependent receptor
Probable TonB-dependent receptor
 
CRON 32.
MADE_02662
 
Pseudoalteromonas atlantica T6c
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -117
score = 5.46922
sequence = AAATAACAACTATTATTATTT

Gene: MADE_02662: putative TonB-dependent receptor
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
putative TonB-dependent receptor
 
CRON 33.
hugA
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
*
Colwellia psychrerythraea 34H

Site:
position = -43
score = 5.4447
sequence = AGATCATAATGATTCTTATTT

Gene: CPS_1858: Heme transport protein
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Heme transport protein
 
CRON 34.
fhuA
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
*
Idiomarina loihiensis L2TR

Site:
position = -66
score = 5.3999
sequence = AAACGCGAATCGTTTTCATTT

Gene: IL2514: Ferrichrome-iron receptor
Ferrichrome-iron receptor
 
CRON 35.
sodA
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
*
Idiomarina loihiensis L2TR

Site:
position = -52
score = 4.77727
sequence = AAATGCAAATGATAATGATTA

Site:
position = -46
score = 5.35606
sequence = AAATGATAATGATTACCGTTA

Gene: IL0798: Manganese superoxide dismutase (EC 1.15.1.1)
Manganese superoxide dismutase (EC 1.15.1.1)
IL0799
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR

Gene: IL0799: Metal transporter, ZIP family
Metal transporter, ZIP family
 
CRON 36.
ATW7_04502
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
*
Alteromonadales bacterium TW-7

Site:
position = -67
score = 5.31494
sequence = AAATGATAATTGTTGCTATTT

Gene: ATW7_04502: Ferrichrome-iron receptor
 
Pseudoalteromonas haloplanktis TAC125
*
Pseudoalteromonas tunicata D2

Site:
position = -75
score = 4.53822
sequence = AAATGAGAATATATACTATTC

Gene: PTD2_05440: Ferrichrome-iron receptor
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Ferrichrome-iron receptor
 
CRON 37.
PTD2_01211
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
*
Pseudoalteromonas tunicata D2

Site:
position = 4
score = 5.18142
sequence = AAATGATAACAGTTATCATGC

Gene: PTD2_01211: TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins
 
CRON 38.
fhuE_1
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
*
Idiomarina loihiensis L2TR

Site:
position = -66
score = 5.18443
sequence = AAATGATAACGATTCGTAGTT

Gene: IL1581: Putative OMR family iron-siderophore receptor precursor
Putative OMR family iron-siderophore receptor precursor
 
CRON 39.
ATW7_00730
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
*
Alteromonadales bacterium TW-7

Site:
position = -61
score = 5.11584
sequence = AAATAGAAATCATTACCATTA

Gene: ATW7_00730: Siderophore biosynthesis L-2,4-diaminobutyrate decarboxylase
 
Pseudoalteromonas haloplanktis TAC125
*
Pseudoalteromonas tunicata D2

Site:
position = -123
score = 4.53822
sequence = GAATAGTATATATTCTCATTT

Gene: PTD2_05445: Siderophore biosynthesis L-2,4-diaminobutyrate decarboxylase
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Siderophore biosynthesis L-2,4-diaminobutyrate decarboxylase
ATW7_00735
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7

Gene: ATW7_00735: Siderophore biosynthesis protein, monooxygenase
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2

Gene: PTD2_05450: Siderophore biosynthesis protein, monooxygenase
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Siderophore biosynthesis protein, monooxygenase
ATW7_00740
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7

Gene: ATW7_00740: Siderophore related permease
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2

Gene: PTD2_05455: Siderophore related permease
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Siderophore related permease
 
CRON 40.
PTD2_14219
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
*3
Pseudoalteromonas tunicata D2

Gene: PTD2_14219: TonB-dependent receptor

Site:
position = 6
score = 5.05656
sequence = AAATTAAATTTATTAGCAATT

Gene: PTD2_06379: TonB-dependent receptor

Gene: PTD2_06369: TonB-dependent receptor
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
TonB-dependent receptor
 
CRON 41.
CPS_4762
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H

Gene: CPS_4762: Ferric siderophore transport system, periplasmic binding protein TonB
*
Alteromonadales bacterium TW-7

Site:
position = -257
score = 5.02491
sequence = TAATGACAATAGCTATCATCT

Gene: ATW7_11686: Ferric siderophore transport system, periplasmic binding protein TonB
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa0528: Ferric siderophore transport system, periplasmic binding protein TonB
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Ferric siderophore transport system, periplasmic binding protein TonB
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD