Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Fur - Vibrionales

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 447 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Vibrio cholerae O1 biovar eltor str. N16961 63 32
Vibrio vulnificus CMCP6 77 37
Vibrio harveyi ATCC BAA-1116 94 45
Vibrio parahaemolyticus RIMD 2210633 91 40
Vibrio shilonii AK1 67 37
Vibrio splendidus LGP32 90 42
Vibrio fischeri ES114 70 24
Vibrio salmonicida LFI1238 54 21
Vibrio angustum S14 64 28
Photobacterium profundum SS9 71 28
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
hutW
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -107
score = 5.33368
sequence = TAATAATAGCAATTATCAATT

Gene: VCA0909: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake
*
Vibrio vulnificus CMCP6

Site:
position = -108
score = 5.58166
sequence = AAATAAGATCAATTATCAATT

Gene: VV21615: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -109
score = 5.58166
sequence = AAATAAGATCAATTATCAATT

Site:
position = -154
score = 5.31682
sequence = TATTGCTAATCATTATCAACT

Gene: VIBHAR_05245: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -109
score = 5.58166
sequence = AAATAAGATCAATTATCAATT

Gene: VPA0427: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake
*
Vibrio shilonii AK1

Site:
position = -107
score = 5.58166
sequence = AAATAAGATCAATTATCAATT

Gene: VSAK1_22234: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake
*
Vibrio splendidus LGP32

Site:
position = -108
score = 5.58166
sequence = AAATAAGATCAATTATCAATT

Gene: VS_II0290: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake
*
Vibrio fischeri ES114

Site:
position = -100
score = 5.68017
sequence = TAATGAGATCAATTATCAATT

Gene: VF_1226: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake
*
Vibrio salmonicida LFI1238

Site:
position = -147
score = 5.77431
sequence = AAATGAGATCAATTATCAATT

Gene: VSAL_I1750: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake
 
Vibrio angustum S14
*
Photobacterium profundum SS9

Site:
position = -287
score = 5.82117
sequence = AAATAAGATTGATTATCATTT

Site:
position = -342
score = 5.44464
sequence = GAATAATATCAATTATCATTT

Gene: PBPRA2102: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake
Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake
huvX
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0908: Putative heme iron utilization protein
 
Vibrio vulnificus CMCP6

Gene: VV21616: Putative heme iron utilization protein
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_05246: Putative heme iron utilization protein
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0428: Putative heme iron utilization protein
 
Vibrio shilonii AK1

Gene: VSAK1_22239: Putative heme iron utilization protein
 
Vibrio splendidus LGP32

Gene: VS_II0291: Putative heme iron utilization protein
 
Vibrio fischeri ES114

Gene: VF_1227: Putative heme iron utilization protein
 
Vibrio salmonicida LFI1238

Gene: VSAL_I1749: Putative heme iron utilization protein
*
Vibrio angustum S14

Site:
position = -206
score = 5.44464
sequence = GAATAATATCAATTATCATTT

Gene: VAS14_03953: Putative heme iron utilization protein
 
Photobacterium profundum SS9

Gene: PBPRA2101: Putative heme iron utilization protein
Putative heme iron utilization protein
hutZ
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0907: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ
 
Vibrio vulnificus CMCP6

Gene: VV21617: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_05247: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0429: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ
 
Vibrio shilonii AK1

Gene: VSAK1_22244: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ
 
Vibrio splendidus LGP32

Gene: VS_II0292: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ
 
Vibrio fischeri ES114

Gene: VF_1228: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ
 
Vibrio salmonicida LFI1238

Gene: VSAL_I1748: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ
 
Vibrio angustum S14

Gene: VAS14_03948: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ
 
Photobacterium profundum SS9

Gene: PBPRA2100: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ
Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ
 
CRON 2.
feoA
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -46
score = 5.05628
sequence = TAATAGTAATATTTCTTATTA

Gene: VC2078: Ferrous iron transport protein A
*
Vibrio vulnificus CMCP6

Site:
position = -42
score = 5.46965
sequence = TAATAAAAATATTTCTCATTT

Gene: VV1_0149: Ferrous iron transport protein A
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -42
score = 5.70954
sequence = TAATAATAATATTTATCATTA

Gene: VIBHAR_01363: Ferrous iron transport protein A
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -36
score = 4.40561
sequence = TAATATTTATCATTAGCAATA

Site:
position = -42
score = 5.80368
sequence = AAATAATAATATTTATCATTA

Gene: VP0857: Ferrous iron transport protein A
*
Vibrio shilonii AK1

Site:
position = -45
score = 5.20311
sequence = TAATGTTAATATTTCTCATTA

Gene: VSAK1_09003: Ferrous iron transport protein A
*
Vibrio splendidus LGP32

Site:
position = -42
score = 5.03381
sequence = TAATAACAATCTTTCTCATTA

Gene: VS_2234: Ferrous iron transport protein A
*
Vibrio fischeri ES114

Site:
position = -35
score = 5.68968
sequence = AAATAATAATGATTCTCACTA

Gene: VF_0833: Ferrous iron transport protein A
*
Vibrio salmonicida LFI1238

Site:
position = -35
score = 5.68968
sequence = AAATAATAATGATTCTCACTA

Gene: VSAL_I2257: Ferrous iron transport protein A
*
Vibrio angustum S14

Site:
position = -36
score = 5.82114
sequence = AAATGCTAATAATTCTTATTA

Gene: VAS14_17796: Ferrous iron transport protein A
*
Photobacterium profundum SS9

Site:
position = -36
score = 5.62849
sequence = AAATACTAATAATTCTTATTA

Gene: PBPRA1058: Ferrous iron transport protein A
Ferrous iron transport protein A
feoB
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC2077: Ferrous iron transport protein B
 
Vibrio vulnificus CMCP6

Gene: VV1_0148: Ferrous iron transport protein B
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_01364: Ferrous iron transport protein B
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP0858: Ferrous iron transport protein B
 
Vibrio shilonii AK1

Gene: VSAK1_09008: Ferrous iron transport protein B
 
Vibrio splendidus LGP32

Gene: VS_2233: Ferrous iron transport protein B
 
Vibrio fischeri ES114

Gene: VF_0834: Ferrous iron transport protein B
 
Vibrio salmonicida LFI1238

Gene: VSAL_I2258: Ferrous iron transport protein B
*2
Vibrio angustum S14

Site:
position = -82
score = 5.14923
sequence = AAGTGATAAGCGATATCATTT

Gene: VAS14_04118: Ferrous iron transport protein B

Gene: VAS14_17801: Ferrous iron transport protein B
 
Photobacterium profundum SS9

Gene: PBPRA1059: Ferrous iron transport protein B
Ferrous iron transport protein B
feoC
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC2076: Ferrous iron transport protein C
 
Vibrio vulnificus CMCP6

Gene: VV1_0147: Ferrous iron transport protein C
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_01365: Ferrous iron transport protein C
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP0859: Ferrous iron transport protein C
 
Vibrio shilonii AK1

Gene: VSAK1_09013: Ferrous iron transport protein C
 
Vibrio splendidus LGP32

Gene: VS_2232: Ferrous iron transport protein C
 
Vibrio fischeri ES114

Gene: VF_0835: Ferrous iron transport protein C
 
Vibrio salmonicida LFI1238

Gene: VSAL_I2259: Ferrous iron transport protein C
 2
Vibrio angustum S14

Gene: VAS14_17806: Ferrous iron transport protein C

Gene: VAS14_04123: Ferrous iron transport protein C
 
Photobacterium profundum SS9

Gene: PBPRA1060: Ferrous iron transport protein C
Ferrous iron transport protein C
 
CRON 3.
COG3315
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = 10
score = 4.92067
sequence = ATTTGAGATTCATTATCATCT

Site:
position = -23
score = 4.36134
sequence = TGTTGAGATAAATTCTCAACA

Gene: VC0091: O-Methyltransferase involved in polyketide biosynthesis
*
Vibrio vulnificus CMCP6

Site:
position = -55
score = 5.86572
sequence = AATTGAGATTTATTATCATTA

Gene: VV1_1167: O-Methyltransferase involved in polyketide biosynthesis
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -57
score = 5.47382
sequence = TATTGAGATTTATTATCATCT

Gene: VIBHAR_00267: O-Methyltransferase involved in polyketide biosynthesis
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -2
score = 5.56521
sequence = AATTGATATTCATTATCATCT

Gene: VP2944: O-Methyltransferase involved in polyketide biosynthesis
*
Vibrio shilonii AK1

Site:
position = -2
score = 5.53584
sequence = AAATGACATTAGTTATCATTT

Gene: VSAK1_13246: O-Methyltransferase involved in polyketide biosynthesis
*
Vibrio splendidus LGP32

Site:
position = -43
score = 5.56521
sequence = AATTGATATTCATTATCATCT

Site:
position = -76
score = 5.1063
sequence = TATTGATATTTACTCTCAATA

Gene: VS_3005: O-Methyltransferase involved in polyketide biosynthesis
*
Vibrio fischeri ES114

Site:
position = -47
score = 5.86303
sequence = TAATGATAGTTATTATCATTT

Site:
position = -53
score = 4.37104
sequence = AAGTGGTAATGATAGTTATTA

Gene: VF_2441: O-Methyltransferase involved in polyketide biosynthesis
*
Vibrio salmonicida LFI1238

Site:
position = -34
score = 5.37394
sequence = TAATGATAGTCATTATCATCT

Site:
position = -40
score = 4.71569
sequence = AATTGGTAATGATAGTCATTA

Gene: VSAL_I2892: O-Methyltransferase involved in polyketide biosynthesis
*
Vibrio angustum S14

Site:
position = -42
score = 5.65981
sequence = AACTGATAATTATTATCATCT

Gene: VAS14_21832: O-Methyltransferase involved in polyketide biosynthesis
*
Photobacterium profundum SS9

Site:
position = -45
score = 5.37394
sequence = TAATGATAGTCATTATCATCT

Gene: PBPRA0166: O-Methyltransferase involved in polyketide biosynthesis
O-Methyltransferase involved in polyketide biosynthesis
 
CRON 4.
irgB
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -131
score = 6.03303
sequence = AAATGATAATTATTCTTAATT

Gene: VC0474: Iron-regulated virulence regulatory protein irgB
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_07055: Iron-regulated virulence regulatory protein irgB
*3
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -124
score = 6.03029
sequence = AATTGATAATGATTATTATTT

Gene: VP2603: Iron-regulated virulence regulatory protein irgB

Gene: VPA1747: Iron-regulated virulence regulatory protein irgB

Gene: VPA0912: Iron-regulated virulence regulatory protein irgB
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114

Gene: VF_A0791: Iron-regulated virulence regulatory protein irgB
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14

Gene: VAS14_11319: Iron-regulated virulence regulatory protein irgB
 
Photobacterium profundum SS9
Iron-regulated virulence regulatory protein irgB
 
CRON 5.
COG0778
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6

Gene: VV1_3131: Nitroreductase
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_03042: Nitroreductase
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP2150: Nitroreductase
*
Vibrio shilonii AK1

Site:
position = -87
score = 5.07431
sequence = GATTGAGAACAGTTCTCACTT

Gene: VSAK1_03499: Nitroreductase
*
Vibrio splendidus LGP32

Site:
position = -76
score = 4.54844
sequence = CGTTGAGATTTATTATCGTTT

Gene: VS_0939: Nitroreductase
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
*
Vibrio angustum S14

Site:
position = -30
score = 5.26267
sequence = AAAAAATAACTATTTTCATTT

Gene: VAS14_05758: Nitroreductase
*
Photobacterium profundum SS9

Site:
position = -19
score = 4.34448
sequence = TTGTAAGAGCAATTATTATTT

Gene: PBPRA2593: Nitroreductase
Nitroreductase
 
CRON 6.
COG4771
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_01404: Outer membrane receptor for ferrienterochelin, TonB-dependent
 
Vibrio parahaemolyticus RIMD 2210633
*
Vibrio shilonii AK1

Site:
position = -39
score = 5.77725
sequence = AAATGCAAACTATTATCATTT

Gene: VSAK1_03309: Outer membrane receptor for ferrienterochelin, TonB-dependent
*
Vibrio splendidus LGP32

Site:
position = -88
score = 5.53559
sequence = AAATGATAACCATTACTATTA

Gene: VS_2395: Outer membrane receptor for ferrienterochelin, TonB-dependent
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
*
Photobacterium profundum SS9

Site:
position = -43
score = 5.50187
sequence = TAACGATAATAATTATCATTC

Gene: PBPRB1825: Outer membrane receptor for ferrienterochelin, TonB-dependent
Outer membrane receptor for ferrienterochelin, TonB-dependent
 
CRON 7.
irpA
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -2
score = 5.81164
sequence = AAATGATAATAATTTGCAATT

Gene: VC1264: Iron-regulated protein A precursor
*
Vibrio vulnificus CMCP6

Site:
position = -38
score = 5.51797
sequence = AAATAAGAATAATTAGCACTA

Gene: VV1_2968: Iron-regulated protein A precursor
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -51
score = 5.51797
sequence = AAATAAGAATAATTAGCACTA

Gene: VIBHAR_02715: Iron-regulated protein A precursor
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -33
score = 5.51797
sequence = AAATAAGAATAATTAGCACTA

Gene: VP1920: Iron-regulated protein A precursor
*
Vibrio shilonii AK1

Site:
position = -55
score = 5.71061
sequence = AAATGATAATAATTCGCACTA

Gene: VSAK1_04580: Iron-regulated protein A precursor
*
Vibrio splendidus LGP32

Site:
position = -61
score = 5.28274
sequence = AAATGATAATGGTTTGCACTA

Gene: VS_1923: Iron-regulated protein A precursor
*
Vibrio fischeri ES114

Site:
position = -132
score = 5.39528
sequence = AAATGATAAGGATTTGCATTT

Site:
position = -87
score = 5.94493
sequence = AAATAAAAATTATTATCATTA

Gene: VF_1190: Iron-regulated protein A precursor
*
Vibrio salmonicida LFI1238

Site:
position = -83
score = 5.70043
sequence = AAATAACAATAATTATCATTA

Site:
position = -128
score = 5.48784
sequence = TAATGATAAATATTTGCATTT

Gene: VSAL_I1786: Iron-regulated protein A precursor
*
Vibrio angustum S14

Site:
position = -73
score = 5.69578
sequence = TAATAATAACAATTATCACTT

Site:
position = -141
score = 5.5025
sequence = AAATGCAAATTATTACCATTA

Gene: VAS14_01246: Iron-regulated protein A precursor
 
Photobacterium profundum SS9
Iron-regulated protein A precursor
 
CRON 8.
viuP
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -2
score = 4.87378
sequence = AAATGAGAATCAATATTACAA

Site:
position = 16
score = 4.79459
sequence = CAATGAAAAACATTTTTATTT

Gene: VC0776: Ferric vibriobactin, enterobactin transport system, substrate-binding protein ViuP (TC 3.A.1.14.6)
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
*
Vibrio splendidus LGP32

Site:
position = -98
score = 4.97029
sequence = AAATGAGAATCAATGTAATTT

Gene: VS_1123: Ferric vibriobactin, enterobactin transport system, substrate-binding protein ViuP (TC 3.A.1.14.6)
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Ferric vibriobactin, enterobactin transport system, substrate-binding protein ViuP (TC 3.A.1.14.6)
viuD
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC0777: Ferric vibriobactin, enterobactin transport system, permease protein ViuD (TC 3.A.1.14.6)
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_1124: Ferric vibriobactin, enterobactin transport system, permease protein ViuD (TC 3.A.1.14.6)
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Ferric vibriobactin, enterobactin transport system, permease protein ViuD (TC 3.A.1.14.6)
viuG
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC0778: Ferric vibriobactin, enterobactin transport system, permease protein ViuG (TC 3.A.1.14.6)
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_1125: Ferric vibriobactin, enterobactin transport system, permease protein ViuG (TC 3.A.1.14.6)
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Ferric vibriobactin, enterobactin transport system, permease protein ViuG (TC 3.A.1.14.6)
 
CRON 9.
VPA0663
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -2
score = 5.38
sequence = TAATGATAATAATTCTCAGGT

Gene: VPA0663: putative transcriptional regulator, AraC/XylS family
 
Vibrio shilonii AK1
*
Vibrio splendidus LGP32

Site:
position = -2
score = 5.93749
sequence = AAATGATAATAATTATCAATC

Gene: VS_II0528: putative transcriptional regulator, AraC/XylS family
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
putative transcriptional regulator, AraC/XylS family
 
CRON 10.
COG2910
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -46
score = 4.48214
sequence = TGATGTAAAGTATTCTCATTA

Gene: VIBHAR_02532: Putative NADH-flavin reductase
 
Vibrio parahaemolyticus RIMD 2210633
*
Vibrio shilonii AK1

Site:
position = -18
score = 4.57373
sequence = AAATTATTATCATTATCAATG

Site:
position = -24
score = 5.13564
sequence = TAGTGTAAATTATTATCATTA

Gene: VSAK1_01252: Putative NADH-flavin reductase
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
*
Vibrio angustum S14

Site:
position = -48
score = 5.58897
sequence = TAATGCAAACTATTATCATTA

Gene: VAS14_10719: Putative NADH-flavin reductase
*
Photobacterium profundum SS9

Site:
position = -46
score = 4.55338
sequence = TAATACGAATTAGAATCATTA

Gene: PBPRB1864: Putative NADH-flavin reductase
Putative NADH-flavin reductase
 
CRON 11.
PF07690
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1

Gene: VSAK1_20934: MFS transporter
*
Vibrio splendidus LGP32

Site:
position = -49
score = 4.39733
sequence = AAATCAAAATGATAATTATTC

Site:
position = -43
score = 4.72169
sequence = AAATGATAATTATTCGCTAAA

Gene: VS_2111: MFS transporter
*
Vibrio fischeri ES114

Site:
position = -76
score = 5.56229
sequence = TAATGATAATTATTTTTATTC

Site:
position = -82
score = 5.01397
sequence = AAATGTTAATGATAATTATTT

Gene: VF_A0157: MFS transporter
*
Vibrio salmonicida LFI1238

Site:
position = -150
score = 4.56715
sequence = AAATAGTAATGATAATTGTTT

Site:
position = -144
score = 5.37674
sequence = TAATGATAATTGTTTTTATTC

Gene: VSAL_II0149: MFS transporter
 
Vibrio angustum S14
 
Photobacterium profundum SS9
MFS transporter
 
CRON 12.
VSAK1_18252
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
*
Vibrio shilonii AK1

Site:
position = -78
score = 6.27995
sequence = TAATGATAATGATTATCATTT

Site:
position = -72
score = 4.52617
sequence = TAATGATTATCATTTTAATCT

Gene: VSAK1_18252: TonB-dependent heme receptor
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
TonB-dependent heme receptor
 
CRON 13.
VPA0882
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -80
score = 5.67039
sequence = TAATGATAGTAATTATTATTT

Site:
position = -64
score = 4.41889
sequence = TATTTAGATCCATTAACATTT

Site:
position = -86
score = 4.67356
sequence = AAATGATAATGATAGTAATTA

Gene: VPA0882: TonB-dependent heme and hemoglobin receptor HutA ; TonB-dependent hemin , ferrichrome receptor
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
TonB-dependent heme and hemoglobin receptor HutA ; TonB-dependent hemin , ferrichrome receptor
 
CRON 14.
vctP
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = 28
score = 4.87655
sequence = TAATGAGAATAAGTATCAAAA

Gene: VCA0227: iron(III) ABC transporter, periplasmic iron-compound-binding protein
 
Vibrio vulnificus CMCP6

Gene: VV20842: iron(III) ABC transporter, periplasmic iron-compound-binding protein
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -31
score = 4.68282
sequence = GCATGATAACGGATCTCATTA

Gene: VIBHAR_06135: iron(III) ABC transporter, periplasmic iron-compound-binding protein
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -33
score = 4.96556
sequence = GCATGATAATAGATCTCATTA

Gene: VPA0657: iron(III) ABC transporter, periplasmic iron-compound-binding protein
*
Vibrio shilonii AK1

Site:
position = -79
score = 5.64765
sequence = AAATGATATTGATTCCCATTT

Site:
position = -52
score = 4.69244
sequence = AAGTGATAATGATTCTGTTTA

Gene: VSAK1_21214: iron(III) ABC transporter, periplasmic iron-compound-binding protein
*
Vibrio splendidus LGP32

Site:
position = -129
score = 5.73695
sequence = AATTGATAATAGTTCTCACTT

Gene: VS_II1071: iron(III) ABC transporter, periplasmic iron-compound-binding protein
*
Vibrio fischeri ES114

Site:
position = -65
score = 5.56805
sequence = TAATAATAACCATTTTCATTA

Site:
position = -34
score = 5.42656
sequence = AAATACGAATAGTTATCACTT

Gene: VF_A0827: iron(III) ABC transporter, periplasmic iron-compound-binding protein
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
iron(III) ABC transporter, periplasmic iron-compound-binding protein
vctD
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0228: Iron(III) ABC transporter, permease protein
 
Vibrio vulnificus CMCP6

Gene: VV20110: Iron(III) ABC transporter, permease protein
*2
Vibrio harveyi ATCC BAA-1116

Site:
position = -320
score = 5.06617
sequence = TGATAGGATTAATTATCATTT

Gene: VIBHAR_02108: Iron(III) ABC transporter, permease protein

Gene: VIBHAR_06134: Iron(III) ABC transporter, permease protein
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0658: Iron(III) ABC transporter, permease protein
 
Vibrio shilonii AK1

Gene: VSAK1_21219: Iron(III) ABC transporter, permease protein
 
Vibrio splendidus LGP32

Gene: VS_II1070: Iron(III) ABC transporter, permease protein
 
Vibrio fischeri ES114

Gene: VF_A0826: Iron(III) ABC transporter, permease protein
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Iron(III) ABC transporter, permease protein
vctB
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0229: Iron(III) ABC transporter, permease protein
 
Vibrio vulnificus CMCP6

Gene: VV20111: Iron(III) ABC transporter, permease protein
 2
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_02107: Iron(III) ABC transporter, permease protein

Gene: VIBHAR_06133: Iron(III) ABC transporter, permease protein
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0659: Iron(III) ABC transporter, permease protein
 
Vibrio shilonii AK1

Gene: VSAK1_21224: Iron(III) ABC transporter, permease protein
 
Vibrio splendidus LGP32

Gene: VS_II1068: Iron(III) ABC transporter, permease protein
 
Vibrio fischeri ES114

Gene: VF_A0825: Iron(III) ABC transporter, permease protein
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Iron(III) ABC transporter, permease protein
vctC
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0230: Iron(III) ABC transporter, ATP-binding protein
 
Vibrio vulnificus CMCP6

Gene: VV20112: Iron(III) ABC transporter, ATP-binding protein
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06132: Iron(III) ABC transporter, ATP-binding protein
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0660: Iron(III) ABC transporter, ATP-binding protein
 
Vibrio shilonii AK1

Gene: VSAK1_21229: Iron(III) ABC transporter, ATP-binding protein
 
Vibrio splendidus LGP32

Gene: VS_II1067: Iron(III) ABC transporter, ATP-binding protein
 
Vibrio fischeri ES114

Gene: VF_A0824: Iron(III) ABC transporter, ATP-binding protein
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Iron(III) ABC transporter, ATP-binding protein
viuB
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
*
Vibrio harveyi ATCC BAA-1116

Site:
position = 4
score = 4.42241
sequence = GAAAGAGAATTGTTATCAAAA

Gene: VIBHAR_06920: Siderophore-interacting protein ViuB
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0089: Siderophore-interacting protein ViuB
*
Vibrio shilonii AK1

Site:
position = -31
score = 5.38917
sequence = AAATGAAAACAATAATCATTA

Gene: VSAK1_05955: Siderophore-interacting protein ViuB
*
Vibrio splendidus LGP32

Site:
position = -76
score = 5.2973
sequence = AAATGATAACTATTAGTATTG

Gene: VS_II0412: Siderophore-interacting protein ViuB
 
Vibrio fischeri ES114

Gene: VF_A0823: Siderophore-interacting protein ViuB
 
Vibrio salmonicida LFI1238
*
Vibrio angustum S14

Site:
position = -29
score = 5.51071
sequence = AAATAAAAACCATTCTCAATT

Gene: VAS14_04423: Siderophore-interacting protein ViuB
 
Photobacterium profundum SS9
Siderophore-interacting protein ViuB
VV20841
 
Vibrio cholerae O1 biovar eltor str. N16961
*
Vibrio vulnificus CMCP6

Site:
position = -113
score = 5.54227
sequence = AAATGGTAATAATAATCATTT

Gene: VV20841: Aryl carrier domain
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Aryl carrier domain
 
CRON 15.
PF03929
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06750: Uncharacterized protein involved in iron uptake
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -59
score = 4.86504
sequence = CAATAAGAATGATTATCACCT

Gene: VPA0157: Uncharacterized protein involved in iron uptake
 
Vibrio shilonii AK1
*
Vibrio splendidus LGP32

Site:
position = -57
score = 4.84533
sequence = CAATACGAATTATTATCAACT

Gene: VS_II0685: Uncharacterized protein involved in iron uptake
 
Vibrio fischeri ES114
*
Vibrio salmonicida LFI1238

Site:
position = -61
score = 4.69492
sequence = CAACGCAAATCATTATCAATT

Gene: VSAL_II0118: Uncharacterized protein involved in iron uptake
*
Vibrio angustum S14

Site:
position = -61
score = 5.2234
sequence = CAATAAGAACGATTATCAATT

Gene: VAS14_12444: Uncharacterized protein involved in iron uptake
*
Photobacterium profundum SS9

Site:
position = -87
score = 5.27092
sequence = CAATGAAAACGATTATCAATT

Gene: PBPRB1213: Uncharacterized protein involved in iron uptake
Uncharacterized protein involved in iron uptake
PF10029
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06749: Predicted periplasmic protein (DUF2271)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0158: Predicted periplasmic protein (DUF2271)
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_II0686: Predicted periplasmic protein (DUF2271)
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0119: Predicted periplasmic protein (DUF2271)
 
Vibrio angustum S14

Gene: VAS14_12439: Predicted periplasmic protein (DUF2271)
 
Photobacterium profundum SS9

Gene: PBPRB1212: Predicted periplasmic protein (DUF2271)
Predicted periplasmic protein (DUF2271)
cbiM
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06748: ABC-type Co2+ transport system, periplasmic component
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0159: ABC-type Co2+ transport system, periplasmic component
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_II0687: ABC-type Co2+ transport system, periplasmic component
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0120: ABC-type Co2+ transport system, periplasmic component
 
Vibrio angustum S14

Gene: VAS14_12434: ABC-type Co2+ transport system, periplasmic component
 
Photobacterium profundum SS9

Gene: PBPRB1211: ABC-type Co2+ transport system, periplasmic component
ABC-type Co2+ transport system, periplasmic component
VIBHAR_06747
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06747: conserved hypothetical protein
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0160: conserved hypothetical protein
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_II0688: conserved hypothetical protein
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0121: conserved hypothetical protein
 
Vibrio angustum S14

Gene: VAS14_12429: conserved hypothetical protein
 
Photobacterium profundum SS9

Gene: PBPRB1210: conserved hypothetical protein
conserved hypothetical protein
VIBHAR_06746
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06746: conserved hypothetical protein
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0161: conserved hypothetical protein
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_II0689: conserved hypothetical protein
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0122: conserved hypothetical protein
 
Vibrio angustum S14

Gene: VAS14_12424: conserved hypothetical protein
 
Photobacterium profundum SS9

Gene: PBPRB1209: conserved hypothetical protein
conserved hypothetical protein
PF01297
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06745: ABC transporter, metal-binding lipoprotein
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0162: ABC transporter, metal-binding lipoprotein
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_II0690: ABC transporter, metal-binding lipoprotein
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0123: ABC transporter, metal-binding lipoprotein
 
Vibrio angustum S14

Gene: VAS14_12419: ABC transporter, metal-binding lipoprotein
 
Photobacterium profundum SS9

Gene: PBPRB1208: ABC transporter, metal-binding lipoprotein
ABC transporter, metal-binding lipoprotein
COG1121
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06744: ABC-type Mn/Zn transport systems, ATPase component
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0163: ABC-type Mn/Zn transport systems, ATPase component
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_II0691: ABC-type Mn/Zn transport systems, ATPase component
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0124: ABC-type Mn/Zn transport systems, ATPase component
 
Vibrio angustum S14

Gene: VAS14_12414: ABC-type Mn/Zn transport systems, ATPase component
 
Photobacterium profundum SS9

Gene: PBPRB1207: ABC-type Mn/Zn transport systems, ATPase component
ABC-type Mn/Zn transport systems, ATPase component
COG1108
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06743: ABC-type Mn2+/Zn2+ transport systems, permease components
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0164: ABC-type Mn2+/Zn2+ transport systems, permease components
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_II0692: ABC-type Mn2+/Zn2+ transport systems, permease components
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0125: ABC-type Mn2+/Zn2+ transport systems, permease components
 
Vibrio angustum S14

Gene: VAS14_12409: ABC-type Mn2+/Zn2+ transport systems, permease components
 
Photobacterium profundum SS9

Gene: PBPRB1206: ABC-type Mn2+/Zn2+ transport systems, permease components
ABC-type Mn2+/Zn2+ transport systems, permease components
COG0803
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06742: ABC-type metal ion transport system, periplasmic component/surface adhesin
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0165: ABC-type metal ion transport system, periplasmic component/surface adhesin
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_II0693: ABC-type metal ion transport system, periplasmic component/surface adhesin
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0126: ABC-type metal ion transport system, periplasmic component/surface adhesin
 
Vibrio angustum S14

Gene: VAS14_12404: ABC-type metal ion transport system, periplasmic component/surface adhesin
 
Photobacterium profundum SS9

Gene: PBPRB1205: ABC-type metal ion transport system, periplasmic component/surface adhesin
ABC-type metal ion transport system, periplasmic component/surface adhesin
 
CRON 16.
COG2132
 
Vibrio cholerae O1 biovar eltor str. N16961
*
Vibrio vulnificus CMCP6

Site:
position = -183
score = 5.20449
sequence = TGTTGAGAATGATTATTAATA

Gene: VV1_0966: Multicopper oxidase
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -65
score = 5.42212
sequence = AACTGAGAATCATTATTAATA

Gene: VIBHAR_00368: Multicopper oxidase
 
Vibrio parahaemolyticus RIMD 2210633
*
Vibrio shilonii AK1

Site:
position = -44
score = 4.83638
sequence = AATTGAGAATCATTATCTAAT

Gene: VSAK1_24319: Multicopper oxidase
*
Vibrio splendidus LGP32

Site:
position = -62
score = 5.39285
sequence = TTATGAGAATTATTCTCAATA

Gene: VS_3101: Multicopper oxidase
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Multicopper oxidase
 
CRON 17.
nrfA
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6

Gene: VV1_3035: Formate-dependent nitrite reductase, periplasmic cytochrome c552 subunit
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_02727: Formate-dependent nitrite reductase, periplasmic cytochrome c552 subunit
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP1929: Formate-dependent nitrite reductase, periplasmic cytochrome c552 subunit
*
Vibrio shilonii AK1

Site:
position = -241
score = 5.71943
sequence = AAATGATAATTAATATCATCA

Gene: VSAK1_05600: Formate-dependent nitrite reductase, periplasmic cytochrome c552 subunit
*
Vibrio splendidus LGP32

Site:
position = -281
score = 5.40717
sequence = ATATGATAATAATTCTCAGTT

Gene: VS_1933: Formate-dependent nitrite reductase, periplasmic cytochrome c552 subunit
*
Vibrio fischeri ES114

Site:
position = -226
score = 5.5546
sequence = AAATAAGAATCATTCTTAATA

Gene: VF_1554: Formate-dependent nitrite reductase, periplasmic cytochrome c552 subunit
*
Vibrio salmonicida LFI1238

Site:
position = -227
score = 5.4635
sequence = AAATAAGAACCATTATTAATA

Gene: VSAL_I1997: Formate-dependent nitrite reductase, periplasmic cytochrome c552 subunit
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRA1258: Formate-dependent nitrite reductase, periplasmic cytochrome c552 subunit
Formate-dependent nitrite reductase, periplasmic cytochrome c552 subunit
 
CRON 18.
sodA
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -37
score = 6.01719
sequence = TAATGATATTAATTATCATTA

Gene: VC2694: Manganese superoxide dismutase (EC 1.15.1.1)
*
Vibrio vulnificus CMCP6

Site:
position = -58
score = 5.55134
sequence = AGTTGATAATGGTTATCATTA

Gene: VV1_1252: Manganese superoxide dismutase (EC 1.15.1.1)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -51
score = 4.75251
sequence = TAATGATTTTCATTAACATTA

Site:
position = -57
score = 5.49732
sequence = AGTTGATAATGATTTTCATTA

Gene: VIBHAR_00151: Manganese superoxide dismutase (EC 1.15.1.1)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -58
score = 4.9832
sequence = AGTTGATAATGACTTTCATTA

Gene: VP2860: Manganese superoxide dismutase (EC 1.15.1.1)
 
Vibrio shilonii AK1
*
Vibrio splendidus LGP32

Site:
position = -58
score = 5.13115
sequence = AGTTGATAATGATTTCCATTA

Site:
position = -52
score = 5.17159
sequence = TAATGATTTCCATTATCATTA

Gene: VS_2918: Manganese superoxide dismutase (EC 1.15.1.1)
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
*
Vibrio angustum S14

Site:
position = -55
score = 6.09746
sequence = TAATGATAATAGTTATCATTA

Gene: VAS14_05603: Manganese superoxide dismutase (EC 1.15.1.1)
*
Photobacterium profundum SS9

Site:
position = -54
score = 5.40553
sequence = TAATGCGAGTAATTATCATTA

Gene: PBPRA2569: Manganese superoxide dismutase (EC 1.15.1.1)
Manganese superoxide dismutase (EC 1.15.1.1)
PF10952
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -53
score = 5.83701
sequence = ACATGATAATAATTATCAATT

Gene: VC1009: Protein of unknown function (DUF2753)
*
Vibrio vulnificus CMCP6

Site:
position = -56
score = 5.74859
sequence = ACATGATAATAATTTTCATTT

Gene: VV1_3101: Protein of unknown function (DUF2753)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -58
score = 5.34437
sequence = ACTTGATAATAATTATCGTTT

Gene: VIBHAR_02989: Protein of unknown function (DUF2753)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -57
score = 5.34437
sequence = ACTTGATAATAATTATCGTTT

Gene: VP2110: Protein of unknown function (DUF2753)
*
Vibrio shilonii AK1

Site:
position = -148
score = 4.99466
sequence = AAATGATAATCGTTATCGAAT

Site:
position = -55
score = 5.71637
sequence = AAATGATAATCAATATCATCT

Gene: VSAK1_20819: Protein of unknown function (DUF2753)
*
Vibrio splendidus LGP32

Site:
position = -56
score = 5.98817
sequence = ACATGATAATAATTATCATTT

Site:
position = -105
score = 4.37369
sequence = AATCGATATTCTTTACTAATT

Site:
position = -112
score = 4.60763
sequence = TATTAATAATCGATATTCTTT

Gene: VS_0969: Protein of unknown function (DUF2753)
*
Vibrio fischeri ES114

Site:
position = -70
score = 5.8061
sequence = AATTGATAATAATTCTCAGTT

Gene: VF_0927: Protein of unknown function (DUF2753)
*
Vibrio salmonicida LFI1238

Site:
position = -61
score = 6.13153
sequence = TAATGATAATAATTCTCAATT

Gene: VSAL_I1864: Protein of unknown function (DUF2753)
 
Vibrio angustum S14

Gene: VAS14_05608: Protein of unknown function (DUF2753)
 
Photobacterium profundum SS9

Gene: PBPRA2570: Protein of unknown function (DUF2753)
Protein of unknown function (DUF2753)
 
CRON 19.
VSAK1_04950
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
*
Vibrio shilonii AK1

Site:
position = -108
score = 5.84242
sequence = AAATGATAATAAATAGCATTA

Gene: VSAK1_04950: TonB-dependent siderophore receptor
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
*
Vibrio angustum S14

Site:
position = -27
score = 5.6407
sequence = AAATGATAATTCATCTCATTT

Gene: VAS14_12284: TonB-dependent siderophore receptor
 
Photobacterium profundum SS9
TonB-dependent siderophore receptor
 
CRON 20.
VIBHAR_03036
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -41
score = 5.73806
sequence = AATTGATAATGATTTTCAATA

Site:
position = -35
score = 5.0343
sequence = TAATGATTTTCAATATCAATT

Gene: VIBHAR_03036: hypothetical protein
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
hypothetical protein
PF00106
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_03037: Short chain dehydrogenase
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -204
score = 5.88922
sequence = AATTGATAATGATTTTCATTA

Gene: VP2146: Short chain dehydrogenase
 
Vibrio shilonii AK1

Gene: VSAK1_03509: Short chain dehydrogenase
*
Vibrio splendidus LGP32

Site:
position = -197
score = 6.09746
sequence = TAATGATAATAGTTATCATTA

Gene: VS_0942: Short chain dehydrogenase
 
Vibrio fischeri ES114

Gene: VF_1658: Short chain dehydrogenase
 
Vibrio salmonicida LFI1238
*
Vibrio angustum S14

Site:
position = -128
score = 6.07483
sequence = AATTGATAATTATTATCAATA

Gene: VAS14_10544: Short chain dehydrogenase
 
Photobacterium profundum SS9
Short chain dehydrogenase
 
CRON 21.
hutA
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6

Gene: VV20276: TonB-dependent heme and hemoglobin receptor HutA ; TonB-dependent hemin , ferrichrome receptor
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -81
score = 5.20837
sequence = GAATGATAGTAATTACCATTT

Gene: VIBHAR_05789: TonB-dependent heme and hemoglobin receptor HutA ; TonB-dependent hemin , ferrichrome receptor
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
TonB-dependent heme and hemoglobin receptor HutA ; TonB-dependent hemin , ferrichrome receptor
 
CRON 22.
fhuA
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -54
score = 5.23312
sequence = AATTGAGAAAGATTCGCAATT

Site:
position = -24
score = 4.49305
sequence = TAATTAAGATAATTATCACTA

Gene: VC0200: TonB-dependent outer membrane receptor for iron siderophores
*
Vibrio vulnificus CMCP6

Site:
position = -47
score = 5.40242
sequence = AAATGAGAATTACTACCATTA

Gene: VV21337: TonB-dependent outer membrane receptor for iron siderophores
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -48
score = 5.55221
sequence = AAATGAGATTTATTACTATTT

Gene: VIBHAR_06299: TonB-dependent outer membrane receptor for iron siderophores
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -57
score = 5.45153
sequence = AAATGATAATAATTACAATTA

Gene: VPA1435: TonB-dependent outer membrane receptor for iron siderophores
 
Vibrio shilonii AK1
*
Vibrio splendidus LGP32

Site:
position = -49
score = 5.55221
sequence = AAATGAGATTTATTACTATTT

Gene: VS_II0501: TonB-dependent outer membrane receptor for iron siderophores
*
Vibrio fischeri ES114

Site:
position = -55
score = 4.72857
sequence = GCAAGAGAATCATTCTCATTT

Gene: VF_A0784: TonB-dependent outer membrane receptor for iron siderophores
*
Vibrio salmonicida LFI1238

Site:
position = -56
score = 4.72857
sequence = GCAAGAGAATCATTCTCATTT

Gene: VSAL_II0909: TonB-dependent outer membrane receptor for iron siderophores
 
Vibrio angustum S14
*
Photobacterium profundum SS9

Site:
position = -138
score = 4.71786
sequence = CAATGATAGTAGTTATCATTG

Gene: PBPRA1566: TonB-dependent outer membrane receptor for iron siderophores
TonB-dependent outer membrane receptor for iron siderophores
fhuC
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC0201: Ferrichrome transport ATP-binding protein FhuC
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06304: Ferrichrome transport ATP-binding protein FhuC
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA1436: Ferrichrome transport ATP-binding protein FhuC
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_II0498: Ferrichrome transport ATP-binding protein FhuC
 
Vibrio fischeri ES114

Gene: VF_A0783: Ferrichrome transport ATP-binding protein FhuC
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0908: Ferrichrome transport ATP-binding protein FhuC
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRA1565: Ferrichrome transport ATP-binding protein FhuC
Ferrichrome transport ATP-binding protein FhuC
fhuD
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC0202: Ferrichrome-binding periplasmic protein precursor (TC 3.A.1.14.3)
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06298: Ferrichrome-binding periplasmic protein precursor (TC 3.A.1.14.3)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA1437: Ferrichrome-binding periplasmic protein precursor (TC 3.A.1.14.3)
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_II0502: Ferrichrome-binding periplasmic protein precursor (TC 3.A.1.14.3)
 
Vibrio fischeri ES114

Gene: VF_A0782: Ferrichrome-binding periplasmic protein precursor (TC 3.A.1.14.3)
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRA1564: Ferrichrome-binding periplasmic protein precursor (TC 3.A.1.14.3)
Ferrichrome-binding periplasmic protein precursor (TC 3.A.1.14.3)
fhuB
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC0203: Ferrichrome transport system permease protein FhuB
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06297: Ferrichrome transport system permease protein FhuB
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA1438: Ferrichrome transport system permease protein FhuB
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_II0503: Ferrichrome transport system permease protein FhuB
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRA1563: Ferrichrome transport system permease protein FhuB
Ferrichrome transport system permease protein FhuB
 
CRON 23.
VSAK1_14737
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
*
Vibrio shilonii AK1

Site:
position = -108
score = 4.59226
sequence = AGATGAAAATAATTGCCACTA

Site:
position = -77
score = 5.40116
sequence = AAATGATAGTAATTCGTATTT

Gene: VSAK1_14737: TonB-dependent hemin , ferrichrome receptor
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
*
Vibrio angustum S14

Site:
position = -80
score = 5.46454
sequence = AAATGATAGTAATTATCGTTT

Gene: VAS14_03678: TonB-dependent hemin , ferrichrome receptor
 
Photobacterium profundum SS9
TonB-dependent hemin , ferrichrome receptor
VCA0575
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -178
score = 5.67749
sequence = TAATGATAATTGCTATCATTT

Gene: VCA0575: Transcriptional regulator, LysR family
*
Vibrio vulnificus CMCP6

Site:
position = -145
score = 5.48039
sequence = TAATGATAATTACTATCATTC

Gene: VV20277: Transcriptional regulator, LysR family
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -173
score = 5.20837
sequence = AAATGGTAATTACTATCATTC

Gene: VIBHAR_05788: Transcriptional regulator, LysR family
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -189
score = 4.41889
sequence = AAATGTTAATGGATCTAAATA

Site:
position = -173
score = 5.67039
sequence = AAATAATAATTACTATCATTA

Site:
position = -167
score = 4.67356
sequence = TAATTACTATCATTATCATTT

Gene: VPA0883: Transcriptional regulator, LysR family
 
Vibrio shilonii AK1

Gene: VSAK1_14742: Transcriptional regulator, LysR family
 
Vibrio splendidus LGP32

Gene: VS_II0749: Transcriptional regulator, LysR family
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14

Gene: VAS14_12529: Transcriptional regulator, LysR family
 
Photobacterium profundum SS9

Gene: PBPRB0921: Transcriptional regulator, LysR family
Transcriptional regulator, LysR family
 
CRON 24.
PBPRB1034
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
*
Photobacterium profundum SS9

Site:
position = -141
score = 4.92052
sequence = TAATACAAATAATAATTATTT

Site:
position = -135
score = 5.94493
sequence = AAATAATAATTATTTTCATTA

Gene: PBPRB1034: hypothetical protein
hypothetical protein
PBPRB1033
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRB1033: hypothetical protein
hypothetical protein
PBPRB1032
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRB1032: High-affinity iron permease
High-affinity iron permease
PBPRB1031
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRB1031: BarJ
BarJ
PBPRB1030
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRB1030: hypothetical protein
hypothetical protein
PBPRB1029
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRB1029: hypothetical protein
hypothetical protein
 
CRON 25.
fepB
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -95
score = 4.97582
sequence = TATTGATATTACTTCTCAGTT

Gene: VIBHAR_06007: ABC-type Fe3+-siderophores transport systems, periplasmic component
 
Vibrio parahaemolyticus RIMD 2210633
*
Vibrio shilonii AK1

Site:
position = -76
score = 4.43217
sequence = TAATAGTATTGATAACCATTA

Site:
position = -70
score = 5.25796
sequence = TATTGATAACCATTATTGTTT

Gene: VSAK1_22029: ABC-type Fe3+-siderophores transport systems, periplasmic component
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
ABC-type Fe3+-siderophores transport systems, periplasmic component
fepD
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 2
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06009: ABC-type Fe3+-siderophore transport system, permease component

Gene: VIBHAR_06008: ABC-type Fe3+-siderophore transport system, permease component
 
Vibrio parahaemolyticus RIMD 2210633
 2
Vibrio shilonii AK1

Gene: VSAK1_22024: ABC-type Fe3+-siderophore transport system, permease component

Gene: VSAK1_22019: ABC-type Fe3+-siderophore transport system, permease component
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
ABC-type Fe3+-siderophore transport system, permease component
fepC
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06010: ABC-type Fe3+-siderophores transport system, ATPase component
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1

Gene: VSAK1_22014: ABC-type Fe3+-siderophores transport system, ATPase component
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
ABC-type Fe3+-siderophores transport system, ATPase component
fepA
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06011: TonB-dependent ferric achromobactin receptor
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -60
score = 5.54018
sequence = AAATAATATTTGTTCTTATTT

Gene: VPA1657: TonB-dependent ferric achromobactin receptor
*
Vibrio shilonii AK1

Site:
position = -69
score = 5.24505
sequence = TATTGATAACTATTATCAAAA

Gene: VSAK1_22009: TonB-dependent ferric achromobactin receptor
*
Vibrio splendidus LGP32

Site:
position = -60
score = 5.35018
sequence = AAATGATATTTGTTCTTATTC

Gene: VS_II1128: TonB-dependent ferric achromobactin receptor
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
*
Vibrio angustum S14

Site:
position = -70
score = 5.56549
sequence = AAGTGATAATTATTTGCATTA

Gene: VAS14_15544: TonB-dependent ferric achromobactin receptor
 
Photobacterium profundum SS9
TonB-dependent ferric achromobactin receptor
 
CRON 26.
iucA
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
*
Vibrio fischeri ES114

Site:
position = -52
score = 5.53394
sequence = TAATGAGAATCATTAGCATTC

Gene: VF_A0161: aerobactin siderophore biosynthesis protein IucA
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
aerobactin siderophore biosynthesis protein IucA
iucB
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114

Gene: VF_A0162: aerobactin siderophore synthesis protein IucB
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
N(6)-hydroxylysine O-acetyltransferase
iucC
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114

Gene: VF_A0163: aerobactin siderophore biosynthesis protein IucC
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
siderophore biosynthesis IucC protein
iucD
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114

Gene: VF_A0164: aerobactin siderophore biosynthesis protein IucD
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
L-lysine 6-monooxygenase
iutA
 
Vibrio cholerae O1 biovar eltor str. N16961
*
Vibrio vulnificus CMCP6

Site:
position = -145
score = 5.2775
sequence = AAAAGAAAATAATTCGCATTT

Site:
position = -97
score = 5.27911
sequence = CAATAATAACAATTCTTATTT

Gene: VV21016: Aerobactin siderophore receptor IutA,TonB-dependent
 
Vibrio harveyi ATCC BAA-1116
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -55
score = 5.08835
sequence = TATTGATAATAAGTATCATTG

Gene: VPA0979: Aerobactin siderophore receptor IutA,TonB-dependent
*
Vibrio shilonii AK1

Site:
position = -112
score = 5.91248
sequence = AAATAGTAATAATTATCATTT

Gene: VSAK1_20974: Aerobactin siderophore receptor IutA,TonB-dependent
*
Vibrio splendidus LGP32

Site:
position = -298
score = 5.36747
sequence = CAATAATAATGATTCTTATTT

Site:
position = -263
score = 4.55501
sequence = TAACGATAATACTTCGTACTT

Gene: VS_2116: Aerobactin siderophore receptor IutA,TonB-dependent
*
Vibrio fischeri ES114

Site:
position = -62
score = 4.46405
sequence = GAATACGGATTTTTATCATTT

Gene: VF_A0165: Aerobactin siderophore receptor IutA,TonB-dependent
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0279: Aerobactin siderophore receptor IutA,TonB-dependent
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Aerobactin siderophore receptor IutA,TonB-dependent
 
CRON 27.
VV20839
 
Vibrio cholerae O1 biovar eltor str. N16961
*
Vibrio vulnificus CMCP6

Site:
position = -133
score = 5.53886
sequence = TAATGATATACATTCTCATTT

Gene: VV20839: Isochorismate pyruvate-lyase of siderophore biosynthesis # Vulnibactin-specific
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Isochorismate pyruvate-lyase of siderophore biosynthesis # Vulnibactin-specific
VC0771
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -167
score = 6.09309
sequence = AAATGATAATTGTTATTATTT

Gene: VC0771: Isochorismatase (EC 3.3.2.1) of siderophore biosynthesis # Vibriobactin-specific, VibB
 
Vibrio vulnificus CMCP6

Gene: VV20838: Isochorismatase (EC 3.3.2.1) of siderophore biosynthesis # Vibriobactin-specific, VibB
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_02097: Isochorismatase (EC 3.3.2.1) of siderophore biosynthesis # Vibriobactin-specific, VibB
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Isochorismatase (EC 3.3.2.1) of siderophore biosynthesis # Vibriobactin-specific, VibB
viuB
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -140
score = 5.53886
sequence = TAATGATATACATTCTCATTT

Gene: VC2210: Vibriobactin utilization protein ViuB
 
Vibrio vulnificus CMCP6

Gene: VV20837: Vibriobactin utilization protein ViuB
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_1122: Vibriobactin utilization protein ViuB
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
*
Photobacterium profundum SS9

Site:
position = -45
score = 5.85483
sequence = AAATGATAATGGTTTTCATTA

Gene: PBPRB1812: Vibriobactin utilization protein ViuB
Vibriobactin utilization protein ViuB
 
CRON 28.
vibF
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -90
score = 4.36914
sequence = TGATAATGATTATTATTAACT

Site:
position = -93
score = 5.93615
sequence = AATTGATAATGATTATTATTA

Gene: VC2209: nonribosomal peptide synthetase VibF
*
Vibrio vulnificus CMCP6

Site:
position = -8
score = 6.08731
sequence = AAATGATAATGATTATTATTA

Site:
position = -176
score = 5.79037
sequence = TAATGATAATTATTATCGTTA

Site:
position = -182
score = 4.82569
sequence = TAATGTTAATGATAATTATTA

Gene: VV20831: nonribosomal peptide synthetase VibF
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -63
score = 4.41901
sequence = AAATGATTATTGTTTGCAAAA

Site:
position = -69
score = 4.59931
sequence = TATTGTAAATGATTATTGTTT

Gene: VIBHAR_02101: nonribosomal peptide synthetase VibF
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
nonribosomal peptide synthetase VibF
VV20830
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6

Gene: VV20830: Non-ribosomal peptide synthetase modules, siderophore biosynthesis # vulnibactin-specific
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -111
score = 5.06617
sequence = AAATGATAATTAATCCTATCA

Gene: VIBHAR_02109: Non-ribosomal peptide synthetase modules, siderophore biosynthesis # vulnibactin-specific
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Non-ribosomal peptide synthetase modules, siderophore biosynthesis # vulnibactin-specific
 
CRON 29.
VC0426
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC0426: Predicted membrane protein
 
Vibrio vulnificus CMCP6

Gene: VV1_1471: Predicted membrane protein
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -60
score = 6.0374
sequence = TAATGATAATAATTCTCAATA

Gene: VIBHAR_03638: Predicted membrane protein
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -58
score = 5.07444
sequence = TAATGAGAAGTATTATCGATA

Gene: VP2647: Predicted membrane protein
*
Vibrio shilonii AK1

Site:
position = -70
score = 4.92022
sequence = GATTGATTTTAATTCTCATTA

Gene: VSAK1_10253: Predicted membrane protein
 
Vibrio splendidus LGP32

Gene: VS_2734: Predicted membrane protein
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14

Gene: VAS14_07930: Predicted membrane protein
 
Photobacterium profundum SS9

Gene: PBPRA0482: Predicted membrane protein
Predicted membrane protein
 
CRON 30.
VCA0743
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0743: uroporphyrinogen decarboxylase
*
Vibrio vulnificus CMCP6

Site:
position = -336
score = 5.06362
sequence = TATCAATAATAATTCTCATTC

Gene: VV20115: uroporphyrinogen decarboxylase
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -305
score = 4.42882
sequence = TAATAATTCTCATTTTCAATA

Site:
position = -311
score = 6.03303
sequence = AATTAATAATAATTCTCATTT

Gene: VIBHAR_06129: uroporphyrinogen decarboxylase
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -216
score = 4.44711
sequence = TAATAAGTAAAGTTATCAGTA

Gene: VPA0666: uroporphyrinogen decarboxylase
 
Vibrio shilonii AK1

Gene: VSAK1_15002: uroporphyrinogen decarboxylase
*
Vibrio splendidus LGP32

Site:
position = -251
score = 4.99031
sequence = ATACAAGAATAATTATCAATT

Gene: VS_II0548: uroporphyrinogen decarboxylase
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
uroporphyrinogen decarboxylase
 
CRON 31.
irgA
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -34
score = 6.03303
sequence = AATTAAGAATAATTATCATTT

Gene: VC0475: TonB-dependent receptor; Enterobactin receptor IrgA
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -33
score = 6.03029
sequence = AAATAATAATCATTATCAATT

Gene: VP2602: TonB-dependent receptor; Enterobactin receptor IrgA
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
TonB-dependent receptor; Enterobactin receptor IrgA
 
CRON 32.
VV21506
 
Vibrio cholerae O1 biovar eltor str. N16961
*
Vibrio vulnificus CMCP6

Site:
position = -79
score = 5.86266
sequence = AATTGATATTCATTCTCATTT

Gene: VV21506: hypothetical protein
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -48
score = 4.89099
sequence = AATTGATATACATTCTCTTTT

Gene: VIBHAR_06888: hypothetical protein
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
*
Vibrio salmonicida LFI1238

Site:
position = -50
score = 5.39348
sequence = AATTGATATAAGTTCTCATTT

Gene: VSAL_I0884: hypothetical protein
 
Vibrio angustum S14
 
Photobacterium profundum SS9
hypothetical protein
 
CRON 33.
fbpA
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = 4
score = 5.17978
sequence = GATTGATAAAGGTTATCATTA

Gene: VC0608: Ferric iron ABC transporter, iron-binding protein
*2
Vibrio vulnificus CMCP6

Gene: VV1_1661: Ferric iron ABC transporter, iron-binding protein

Site:
position = -42
score = 5.19986
sequence = TACTGATAAACGTTATCATTA

Gene: VV1_1660: Ferric iron ABC transporter, iron-binding protein
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -41
score = 5.294
sequence = AACTGATAAACGTTATCATTA

Gene: VIBHAR_03435: Ferric iron ABC transporter, iron-binding protein
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -40
score = 5.294
sequence = AACTGATAAACGTTATCATTA

Gene: VP2491: Ferric iron ABC transporter, iron-binding protein
 
Vibrio shilonii AK1

Gene: VSAK1_08024: Ferric iron ABC transporter, iron-binding protein
*
Vibrio splendidus LGP32

Site:
position = -41
score = 5.05958
sequence = AACTGATAGACATTATCATTT

Gene: VS_2518: Ferric iron ABC transporter, iron-binding protein
*
Vibrio fischeri ES114

Site:
position = -53
score = 5.93921
sequence = TATTGATAATTATTATTATTA

Site:
position = -47
score = 4.88867
sequence = TAATTATTATTATTACCATTT

Gene: VF_2151: Ferric iron ABC transporter, iron-binding protein
*
Vibrio salmonicida LFI1238

Site:
position = -53
score = 5.37443
sequence = TATTGATAAGTATTCTTATTA

Gene: VSAL_I2588: Ferric iron ABC transporter, iron-binding protein
*
Vibrio angustum S14

Site:
position = -46
score = 5.55937
sequence = TATTGAGAAACATTATCATTA

Gene: VAS14_20031: Ferric iron ABC transporter, iron-binding protein
*
Photobacterium profundum SS9

Site:
position = -2
score = 5.51356
sequence = TATTGATAATTGTTATCATTG

Gene: PBPRA3184: Ferric iron ABC transporter, iron-binding protein
Ferric iron ABC transporter, iron-binding protein
fbpB
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC0609: Ferric iron ABC transporter, permease protein
 
Vibrio vulnificus CMCP6

Gene: VV1_1662: Ferric iron ABC transporter, permease protein
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_03434: Ferric iron ABC transporter, permease protein
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP2490: Ferric iron ABC transporter, permease protein
 
Vibrio shilonii AK1

Gene: VSAK1_08029: Ferric iron ABC transporter, permease protein
 
Vibrio splendidus LGP32

Gene: VS_2517: Ferric iron ABC transporter, permease protein
 
Vibrio fischeri ES114

Gene: VF_2150: Ferric iron ABC transporter, permease protein
 
Vibrio salmonicida LFI1238

Gene: VSAL_I2587: Ferric iron ABC transporter, permease protein
 
Vibrio angustum S14

Gene: VAS14_20036: Ferric iron ABC transporter, permease protein
 
Photobacterium profundum SS9

Gene: PBPRA3183: Ferric iron ABC transporter, permease protein
Ferric iron ABC transporter, permease protein
fbpC
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC0610: Ferric iron ABC transporter, ATP-binding protein
 
Vibrio vulnificus CMCP6

Gene: VV1_1663: Ferric iron ABC transporter, ATP-binding protein
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_03433: Ferric iron ABC transporter, ATP-binding protein
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP2489: Ferric iron ABC transporter, ATP-binding protein
 
Vibrio shilonii AK1

Gene: VSAK1_08034: Ferric iron ABC transporter, ATP-binding protein
 
Vibrio splendidus LGP32

Gene: VS_2516: Ferric iron ABC transporter, ATP-binding protein
 
Vibrio fischeri ES114

Gene: VF_2149: Ferric iron ABC transporter, ATP-binding protein
 
Vibrio salmonicida LFI1238

Gene: VSAL_I2586: Ferric iron ABC transporter, ATP-binding protein
 
Vibrio angustum S14

Gene: VAS14_20041: Ferric iron ABC transporter, ATP-binding protein
 
Photobacterium profundum SS9

Gene: PBPRA3182: Ferric iron ABC transporter, ATP-binding protein
Ferric iron ABC transporter, ATP-binding protein
 
CRON 34.
VV20793
 
Vibrio cholerae O1 biovar eltor str. N16961
*
Vibrio vulnificus CMCP6

Site:
position = -95
score = 4.80205
sequence = AAATGATATAAACTTGCATTT

Site:
position = -78
score = 5.53046
sequence = ATTTGATAATAATTTTCATTT

Gene: VV20793: Conserved hypothetical protein
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -50
score = 5.81474
sequence = AATTGATAATTAATTTCATTT

Site:
position = -73
score = 4.76887
sequence = AAATGAAAACAAGTCGCACTT

Gene: VIBHAR_05095: Conserved hypothetical protein
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -57
score = 5.71754
sequence = AATTGATAATCAATTTCATTT

Site:
position = -80
score = 4.81677
sequence = AAATGAAAACAATACGCACTT

Gene: VPA1494: Conserved hypothetical protein
*2
Vibrio shilonii AK1

Site:
position = -40
score = 5.54582
sequence = AAATGATATTTATTTGCAATT

Site:
position = -23
score = 4.63802
sequence = AATTGATTCTAATTTGCATTT

Gene: VSAK1_06125: Conserved hypothetical protein

Site:
position = -73
score = 5.06605
sequence = AAATGATAATTACTTGCATTC

Gene: VSAK1_17632: Conserved hypothetical protein
*
Vibrio splendidus LGP32

Site:
position = -72
score = 4.60032
sequence = GAATGATTTTAATTTGCAATT

Site:
position = -55
score = 5.96017
sequence = AATTGATAATAAATATCATTA

Site:
position = -49
score = 4.68025
sequence = TAATAAATATCATTAACATTT

Gene: VS_II1376: Conserved hypothetical protein
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
*
Photobacterium profundum SS9

Site:
position = -54
score = 5.86297
sequence = AATTGATAATGAATATCATTA

Gene: PBPRB1172: Conserved hypothetical protein
Conserved hypothetical protein
VV20794
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6

Gene: VV20794: ABC transporter, ATP-binding protein
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_05094: ABC transporter, ATP-binding protein
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA1495: ABC transporter, ATP-binding protein
 
Vibrio shilonii AK1

Gene: VSAK1_17627: ABC transporter, ATP-binding protein
 
Vibrio splendidus LGP32

Gene: VS_II1377: ABC transporter, ATP-binding protein
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRB1173: ABC transporter, ATP-binding protein
ABC transporter, ATP-binding protein
 
CRON 35.
VCA1041
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -61
score = 5.16447
sequence = TTTTGAGAATAAATATCAATT

Gene: VCA1041: Phosphomannomutase
*
Vibrio vulnificus CMCP6

Site:
position = -57
score = 6.20547
sequence = AAATGATATTTATTATCATTT

Gene: VV20569: Phosphomannomutase
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -93
score = 4.57184
sequence = AATTGAGAACCATTTACATTG

Gene: VIBHAR_06273: Phosphomannomutase
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -99
score = 5.00459
sequence = AATTGAGAACCATTTACATTA

Gene: VPA0535: Phosphomannomutase
*
Vibrio shilonii AK1

Site:
position = -98
score = 4.35644
sequence = TAATGATATTGAGAGTCATTT

Gene: VSAK1_17622: Phosphomannomutase
*
Vibrio splendidus LGP32

Site:
position = -63
score = 5.76333
sequence = AAATGATAATCAGTATCATTT

Gene: VS_II0364: Phosphomannomutase
*
Vibrio fischeri ES114

Site:
position = -59
score = 5.84211
sequence = AATTGATAATGTTTATCATTT

Gene: VF_1056: Phosphomannomutase
 
Vibrio salmonicida LFI1238
*
Vibrio angustum S14

Site:
position = -123
score = 5.53576
sequence = TAATGCGAATGTTTATCATTT

Gene: VAS14_13784: Phosphomannomutase
*
Photobacterium profundum SS9

Site:
position = -63
score = 5.65077
sequence = TAATGCGAATGAATATCATTT

Gene: PBPRB0614: Phosphomannomutase
Phosphomannomutase
 
CRON 36.
PF11449
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = 1
score = 4.86436
sequence = TGTCGATAATAATTCTCATTC

Site:
position = -24
score = 5.1337
sequence = AATTGCGAATAGTTCTCAACT

Gene: VC1688: Predicted manganese transporter, 11 TMS
*
Vibrio vulnificus CMCP6

Site:
position = -62
score = 5.46499
sequence = TATTGCGAATAATTCTCACTT

Site:
position = -36
score = 5.99285
sequence = TAATGATAATCATTCTTATTT

Gene: VV1_2889: Predicted manganese transporter, 11 TMS
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -36
score = 5.91653
sequence = TAATGAGAATTATTACCATTT

Site:
position = -62
score = 5.46499
sequence = TATTGCGAATAATTCTCACTT

Gene: VIBHAR_01859: Predicted manganese transporter, 11 TMS
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -30
score = 4.4636
sequence = TAATTATTACCATTTGCATTT

Site:
position = -62
score = 5.50235
sequence = TATTGCGAATAAATCTCATTT

Site:
position = -36
score = 6.01099
sequence = TAATGATAATTATTACCATTT

Gene: VP1164: Predicted manganese transporter, 11 TMS
*
Vibrio shilonii AK1

Site:
position = -63
score = 5.05425
sequence = CATTGAGAATTATTCTCATAT

Site:
position = -37
score = 6.28269
sequence = TAATGATAATAATTCTCATTT

Gene: VSAK1_04382: Predicted manganese transporter, 11 TMS
*
Vibrio splendidus LGP32

Site:
position = -61
score = 5.93749
sequence = AATTGATAATTATTATCATTC

Site:
position = -67
score = 4.3675
sequence = GAATGCAATTGATAATTATTA

Gene: VS_2002: Predicted manganese transporter, 11 TMS
*
Vibrio fischeri ES114

Site:
position = -39
score = 5.30436
sequence = TACTAATAATCATTCGCATTT

Site:
position = -65
score = 5.83377
sequence = AGTTGATAATAATTCTCATTT

Site:
position = -72
score = 4.55738
sequence = AAATGATAGTTGATAATAATT

Gene: VF_A0848: Predicted manganese transporter, 11 TMS
*
Vibrio salmonicida LFI1238

Site:
position = -39
score = 5.30436
sequence = TACTAATAATCATTCGCATTT

Site:
position = -72
score = 4.55738
sequence = AAATGATAGTTGATAATAATT

Site:
position = -65
score = 5.83377
sequence = AGTTGATAATAATTCTCATTT

Gene: VSAL_II0074: Predicted manganese transporter, 11 TMS
 
Vibrio angustum S14
*
Photobacterium profundum SS9

Site:
position = -77
score = 5.74255
sequence = ACTTGATAATAATTCTCATTT

Site:
position = -71
score = 4.4052
sequence = TAATAATTCTCATTTGCATTT

Gene: PBPRB2013: Predicted manganese transporter, 11 TMS
Predicted manganese transporter, 11 TMS
 
CRON 37.
VSAK1_03314
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
*
Vibrio shilonii AK1

Site:
position = -102
score = 5.77725
sequence = AAATGATAATAGTTTGCATTT

Gene: VSAK1_03314: putative transcriptional regulator, AraC/XylS family protein
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
putative transcriptional regulator, AraC/XylS family protein
 
CRON 38.
pVSAL320_27
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
*
Vibrio salmonicida LFI1238

Site:
position = -66
score = 5.72704
sequence = AAATGAGATTCATTATTATTA

Gene: pVSAL320_27: putative periplasmic iron siderophore binding protein of ABC transporter
 
Vibrio angustum S14
 
Photobacterium profundum SS9
putative periplasmic iron siderophore binding protein of ABC transporter
pVSAL320_28
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238

Gene: pVSAL320_28: transport system permease protein
 
Vibrio angustum S14
 
Photobacterium profundum SS9
transport system permease protein
pVSAL320_29
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238

Gene: pVSAL320_29: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)
pVSAL320_30
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238

Gene: pVSAL320_30: hypothetical protein
 
Vibrio angustum S14
 
Photobacterium profundum SS9
hypothetical protein
 
CRON 39.
VC0773
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -114
score = 4.6574
sequence = AAATGGAAATTGCTTGCATTT

Site:
position = -91
score = 5.66493
sequence = TAATAAAAACTATTCTCATTT

Gene: VC0773: Isochorismate synthase (EC 5.4.4.2) of siderophore biosynthesis # Vibriobactin-specific
*
Vibrio vulnificus CMCP6

Site:
position = -264
score = 4.70318
sequence = TAATTATTATCGTTAGCATTT

Site:
position = -270
score = 5.79037
sequence = TAATGATAATTATTATCGTTA

Gene: VV20835: Isochorismate synthase (EC 5.4.4.2) of siderophore biosynthesis # Vibriobactin-specific
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -50
score = 5.2635
sequence = AAATGAGAAGGGATCTCATTT

Site:
position = -113
score = 4.99009
sequence = GAGTGATAATTATTATCAAAA

Site:
position = -119
score = 4.55283
sequence = TAATGCGAGTGATAATTATTA

Gene: VIBHAR_01398: Isochorismate synthase (EC 5.4.4.2) of siderophore biosynthesis # Vibriobactin-specific
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRB1824: Isochorismate synthase (EC 5.4.4.2) of siderophore biosynthesis # Vibriobactin-specific
Isochorismate synthase (EC 5.4.4.2) of siderophore biosynthesis # Vibriobactin-specific
VC0772
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC0772: 2,3-dihydroxybenzoate-AMP ligase (EC 2.7.7.58) # Vibriobactin-specific, VibE
 
Vibrio vulnificus CMCP6

Gene: VV20836: 2,3-dihydroxybenzoate-AMP ligase (EC 2.7.7.58) # Vibriobactin-specific, VibE
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_01399: 2,3-dihydroxybenzoate-AMP ligase (EC 2.7.7.58) # Vibriobactin-specific, VibE
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRB1823: 2,3-dihydroxybenzoate-AMP ligase (EC 2.7.7.58) # Vibriobactin-specific, VibE
2,3-dihydroxybenzoate-AMP ligase (EC 2.7.7.58) # Vibriobactin-specific, VibE
 
CRON 40.
mntH
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -66
score = 5.31875
sequence = AGGTGATATTGATTCTCATTT

Gene: VIBHAR_04897: Manganese transport protein MntH
 
Vibrio parahaemolyticus RIMD 2210633
*
Vibrio shilonii AK1

Site:
position = -67
score = 5.35301
sequence = AGATGCGATTGATTATCATTT

Gene: VSAK1_15507: Manganese transport protein MntH
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
*
Vibrio angustum S14

Site:
position = -61
score = 5.6242
sequence = AAATGACATTGATTATCATTT

Gene: VAS14_12039: Manganese transport protein MntH
 
Photobacterium profundum SS9
Manganese transport protein MntH
 
CRON 41.
hutA
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
*
Vibrio shilonii AK1

Site:
position = -84
score = 5.54251
sequence = AAATAATAATACATATCATTT

Gene: VSAK1_23799: TonB-dependent heme and hemoglobin receptor HutA ; TonB-dependent hemin , ferrichrome receptor
 
Vibrio splendidus LGP32

Gene: VS_II0751: TonB-dependent heme and hemoglobin receptor HutA ; TonB-dependent hemin , ferrichrome receptor
*
Vibrio fischeri ES114

Site:
position = -69
score = 4.41997
sequence = TAGTAATTATCATTCGTAATA

Site:
position = -81
score = 4.43399
sequence = AAATGAAAATGATAGTAATTA

Site:
position = -75
score = 5.57453
sequence = AAATGATAGTAATTATCATTC

Gene: VF_1234: TonB-dependent heme and hemoglobin receptor HutA ; TonB-dependent hemin , ferrichrome receptor
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
*
Photobacterium profundum SS9

Site:
position = -79
score = 5.27595
sequence = TAACGATAGTAATTCTCATTT

Gene: PBPRA1535: TonB-dependent heme and hemoglobin receptor HutA ; TonB-dependent hemin , ferrichrome receptor
TonB-dependent heme and hemoglobin receptor HutA ; TonB-dependent hemin , ferrichrome receptor
 
CRON 42.
VV21010
 
Vibrio cholerae O1 biovar eltor str. N16961
*
Vibrio vulnificus CMCP6

Site:
position = -75
score = 5.06739
sequence = AAATGAGAATCAATTGTAATA

Gene: VV21010: Hypothetical protein in aerobactin uptake cluster
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Hypothetical protein in aerobactin uptake cluster
fhuC
 
Vibrio cholerae O1 biovar eltor str. N16961
*
Vibrio vulnificus CMCP6

Site:
position = -81
score = 4.7806
sequence = TTATGAAAACAATTCTCATTG

Gene: VV21011: ABC-type cobalamin/Fe3+-siderophores transport system, ATPase component
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1

Gene: VSAK1_20939: ABC-type cobalamin/Fe3+-siderophores transport system, ATPase component
*
Vibrio splendidus LGP32

Site:
position = -73
score = 4.39733
sequence = GAATAATTATCATTTTGATTT

Site:
position = -79
score = 4.72169
sequence = TTTAGCGAATAATTATCATTT

Gene: VS_2112: ABC-type cobalamin/Fe3+-siderophores transport system, ATPase component
*
Vibrio fischeri ES114

Site:
position = -31
score = 5.56229
sequence = GAATAAAAATAATTATCATTA

Site:
position = -25
score = 5.01397
sequence = AAATAATTATCATTAACATTT

Gene: VF_A0158: ABC-type cobalamin/Fe3+-siderophores transport system, ATPase component
*
Vibrio salmonicida LFI1238

Site:
position = -75
score = 4.56715
sequence = AAACAATTATCATTACTATTT

Site:
position = -81
score = 5.37674
sequence = GAATAAAAACAATTATCATTA

Gene: VSAL_II0150: ABC-type cobalamin/Fe3+-siderophores transport system, ATPase component
 
Vibrio angustum S14
 
Photobacterium profundum SS9
ABC-type cobalamin/Fe3+-siderophores transport system, ATPase component
fhuD
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6

Gene: VV21012: ABC-type Fe3+-hydroxamate transport system, periplasmic component
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1

Gene: VSAK1_20944: ABC-type Fe3+-hydroxamate transport system, periplasmic component
 
Vibrio splendidus LGP32

Gene: VS_2113: ABC-type Fe3+-hydroxamate transport system, periplasmic component
 
Vibrio fischeri ES114

Gene: VF_A0159: ABC-type Fe3+-hydroxamate transport system, periplasmic component
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0151: ABC-type Fe3+-hydroxamate transport system, periplasmic component
 
Vibrio angustum S14
 
Photobacterium profundum SS9
ABC-type Fe3+-hydroxamate transport system, periplasmic component
fhuB
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6

Gene: VV21013: ABC-type Fe3+-siderophore transport system, permease component
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1

Gene: VSAK1_20949: ABC-type Fe3+-siderophore transport system, permease component
 
Vibrio splendidus LGP32

Gene: VS_2114: ABC-type Fe3+-siderophore transport system, permease component
 
Vibrio fischeri ES114

Gene: VF_A0160: ABC-type Fe3+-siderophore transport system, permease component
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0152: ABC-type Fe3+-siderophore transport system, permease component
 
Vibrio angustum S14
 
Photobacterium profundum SS9
ABC-type Fe3+-siderophore transport system, permease component
 
CRON 43.
bfd
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -54
score = 4.88758
sequence = AAATAAGAGTGATTCTCTTTT

Gene: VC0364: Bacterioferritin-associated ferredoxin
*
Vibrio vulnificus CMCP6

Site:
position = -57
score = 5.53794
sequence = TAATGATAATGATTATCTATT

Gene: VV1_1340: Bacterioferritin-associated ferredoxin
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -58
score = 4.53494
sequence = TAACAAGAACGATTCTTGTTT

Gene: VIBHAR_00053: Bacterioferritin-associated ferredoxin
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -59
score = 4.36142
sequence = TAACAAGAACCATTCCCGTTT

Gene: VP2769: Bacterioferritin-associated ferredoxin
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
*
Photobacterium profundum SS9

Site:
position = -59
score = 5.09296
sequence = AAATGCAAACGATTCTCGTTT

Gene: PBPRA0317: Bacterioferritin-associated ferredoxin
Bacterioferritin-associated ferredoxin
bfr
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC0365: Bacterioferritin
 
Vibrio vulnificus CMCP6

Gene: VV1_1341: Bacterioferritin
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_00052: Bacterioferritin
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP2768: Bacterioferritin
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRA0318: Bacterioferritin
Bacterioferritin
 
CRON 44.
torS
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -41
score = 5.35212
sequence = TAACGATAATTATTCTTAATA

Gene: VCA0068: Methyl-accepting chemotaxis protein
*
Vibrio vulnificus CMCP6

Site:
position = -49
score = 5.20015
sequence = CAATAATATTCATTCTCATTA

Gene: VV21555: Methyl-accepting chemotaxis protein
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -2
score = 5.33438
sequence = AAATGATAATAGTTATAATCT

Gene: VIBHAR_05136: Methyl-accepting chemotaxis protein
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -40
score = 4.47896
sequence = TAATAATAATGATAATAATCA

Gene: VPA1462: Methyl-accepting chemotaxis protein
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_II0204: Methyl-accepting chemotaxis protein
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Methyl-accepting chemotaxis protein
 
CRON 45.
PBPRB1816
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
*
Photobacterium profundum SS9

Site:
position = -121
score = 5.31972
sequence = GATTGATAACTATTTTTATTT

Gene: PBPRB1816: Ferrichrome transport system permease protein FhuB (TC 3.A.1.14.3)
Ferrichrome transport system permease protein FhuB (TC 3.A.1.14.3)
PBPRB1815
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRB1815: ABC-type Fe3+-siderophore transport system, permease component
ABC-type Fe3+-siderophore transport system, permease component
VIBHAR_01766
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_01766: Ferrichrome transport ATP-binding protein FhuC (TC 3.A.1.14.3)
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRB1814: Ferrichrome transport ATP-binding protein FhuC (TC 3.A.1.14.3)
Ferrichrome transport ATP-binding protein FhuC (TC 3.A.1.14.3)
VIBHAR_01763
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -29
score = 5.18994
sequence = AAATATCAATAATTATCATTT

Gene: VIBHAR_01763: Iron(III) dicitrate transport system, periplasmic iron-binding protein FecB (TC 3.A.1.14.1)
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Iron(III) dicitrate transport system, periplasmic iron-binding protein FecB (TC 3.A.1.14.1)
VIBHAR_01767
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_01767: hypothetical protein
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114

Gene: VF_A0488: hypothetical protein
*
Vibrio salmonicida LFI1238

Site:
position = -30
score = 4.9911
sequence = AAATAAGAATAATTACTAAGT

Gene: VSAL_II0573: hypothetical protein
 
Vibrio angustum S14
 
Photobacterium profundum SS9
hypothetical protein
 
CRON 46.
VC1572
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -40
score = 5.61803
sequence = ATGTGATAATAATTATCATTT

Gene: VC1572: hypothetical protein
 
Vibrio vulnificus CMCP6
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -41
score = 6.13185
sequence = TATTGATAATAATTATCATTA

Site:
position = -38
score = 4.5203
sequence = TGATAATAATTATCATTATCT

Gene: VIBHAR_00162: hypothetical protein
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -41
score = 6.22599
sequence = AATTGATAATAATTATCATTA

Site:
position = -38
score = 4.5203
sequence = TGATAATAATTATCATTATCT

Gene: VP2872: hypothetical protein
 
Vibrio shilonii AK1
*
Vibrio splendidus LGP32

Site:
position = -45
score = 5.6759
sequence = ATTTGATAATAATTATCATTA

Site:
position = -39
score = 4.53719
sequence = TAATAATTATCATTAACATTC

Gene: VS_2936: hypothetical protein
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
*
Vibrio angustum S14

Site:
position = -98
score = 5.56567
sequence = AGATGATAATAATTATCAGTA

Site:
position = -92
score = 4.49362
sequence = TAATAATTATCAGTAGCAATT

Site:
position = -44
score = 5.60191
sequence = CAATGATAATGATTATCAATA

Gene: VAS14_13589: hypothetical protein
 
Photobacterium profundum SS9
hypothetical protein
fumC
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1573: Fumarate hydratase class II (EC 4.2.1.2)
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_00163: Fumarate hydratase class II (EC 4.2.1.2)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP2873: Fumarate hydratase class II (EC 4.2.1.2)
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_2937: Fumarate hydratase class II (EC 4.2.1.2)
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14

Gene: VAS14_13594: Fumarate hydratase class II (EC 4.2.1.2)
 
Photobacterium profundum SS9

Gene: PBPRB0402: Fumarate hydratase class II (EC 4.2.1.2)
Fumarate hydratase class II (EC 4.2.1.2)
 
CRON 47.
VV1_2646
 
Vibrio cholerae O1 biovar eltor str. N16961
*
Vibrio vulnificus CMCP6

Site:
position = -23
score = 5.01868
sequence = AAATAGGACTTATTCTCATTA

Gene: VV1_2646: ABC-type multidrug transport system, ATPase and permease component
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -24
score = 4.86752
sequence = TAATAGGACTTATTCTCAATT

Gene: VIBHAR_02349: ABC-type multidrug transport system, ATPase and permease component
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -24
score = 4.96165
sequence = AAATAGGACTTATTCTCAATT

Gene: VP1609: ABC-type multidrug transport system, ATPase and permease component
*
Vibrio shilonii AK1

Site:
position = -23
score = 4.6485
sequence = TAATAGGAACTATTCTCAAAA

Gene: VSAK1_05315: ABC-type multidrug transport system, ATPase and permease component
*
Vibrio splendidus LGP32

Site:
position = -23
score = 5.01868
sequence = AAATAGGACTTATTCTCATTA

Gene: VS_1414: ABC-type multidrug transport system, ATPase and permease component
*
Vibrio fischeri ES114

Site:
position = -26
score = 4.43344
sequence = AGATAATAATAGGAATCATTA

Site:
position = -20
score = 5.22938
sequence = TAATAGGAATCATTATCACTA

Gene: VF_1277: ABC-type multidrug transport system, ATPase and permease component
*
Vibrio salmonicida LFI1238

Site:
position = -20
score = 5.00535
sequence = TAATAGGAATCATTCTCATTG

Gene: VSAL_I1541: ABC-type multidrug transport system, ATPase and permease component
*
Vibrio angustum S14

Site:
position = -60
score = 4.72592
sequence = AAATGAAAACACTTAACAATA

Site:
position = -41
score = 4.79663
sequence = TAATAGGAATCATTATCACTG

Gene: VAS14_02953: ABC-type multidrug transport system, ATPase and permease component
 
Photobacterium profundum SS9

Gene: PBPRA1924: ABC-type multidrug transport system, ATPase and permease component
ABC-type multidrug transport system, ATPase and permease component
pqiA
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1500: Paraquat-inducible protein A
 
Vibrio vulnificus CMCP6

Gene: VV1_2647: Paraquat-inducible protein A
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_02350: Paraquat-inducible protein A
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP1610: Paraquat-inducible protein A
 
Vibrio shilonii AK1

Gene: VSAK1_05320: Paraquat-inducible protein A
 
Vibrio splendidus LGP32

Gene: VS_1413: Paraquat-inducible protein A
 
Vibrio fischeri ES114

Gene: VF_1276: Paraquat-inducible protein A
 
Vibrio salmonicida LFI1238

Gene: VSAL_I1540: Paraquat-inducible protein A
 
Vibrio angustum S14

Gene: VAS14_02958: Paraquat-inducible protein A
 
Photobacterium profundum SS9

Gene: PBPRA1925: Paraquat-inducible protein A
Paraquat-inducible protein A
pqiB
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1501: Paraquat-inducible protein B
 
Vibrio vulnificus CMCP6

Gene: VV1_2648: Paraquat-inducible protein B
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_02351: Paraquat-inducible protein B
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP1611: Paraquat-inducible protein B
 
Vibrio shilonii AK1

Gene: VSAK1_05325: Paraquat-inducible protein B
 
Vibrio splendidus LGP32

Gene: VS_1412: Paraquat-inducible protein B
 
Vibrio fischeri ES114

Gene: VF_1275: Paraquat-inducible protein B
 
Vibrio salmonicida LFI1238

Gene: VSAL_I1539: Paraquat-inducible protein B
 
Vibrio angustum S14

Gene: VAS14_02963: Paraquat-inducible protein B
 
Photobacterium profundum SS9

Gene: PBPRA1926: Paraquat-inducible protein B
Paraquat-inducible protein B
 
CRON 48.
frdA
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC2656: fumarate reductase, flavoprotein subunit
 
Vibrio vulnificus CMCP6

Gene: VV1_1269: fumarate reductase, flavoprotein subunit
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_00131: fumarate reductase, flavoprotein subunit
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP2840: fumarate reductase, flavoprotein subunit
*
Vibrio shilonii AK1

Site:
position = -256
score = 4.85498
sequence = AAATCATAATTAAACTCATTA

Gene: VSAK1_11298: fumarate reductase, flavoprotein subunit
 
Vibrio splendidus LGP32

Gene: VS_0248: fumarate reductase, flavoprotein subunit
*
Vibrio fischeri ES114

Site:
position = -298
score = 5.25694
sequence = CAATAAGAATCATTATCACTT

Gene: VF_2334: fumarate reductase, flavoprotein subunit
*
Vibrio salmonicida LFI1238

Site:
position = -256
score = 4.86504
sequence = CGATAAGAATCATTATCACTT

Gene: VSAL_I2788: fumarate reductase, flavoprotein subunit
 
Vibrio angustum S14

Gene: VAS14_18896: fumarate reductase, flavoprotein subunit
 
Photobacterium profundum SS9

Gene: PBPRA3378: fumarate reductase, flavoprotein subunit
fumarate reductase, flavoprotein subunit
frdB
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC2657: fumarate reductase, iron-sulfur protein
 
Vibrio vulnificus CMCP6

Gene: VV1_1268: fumarate reductase, iron-sulfur protein
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_00132: fumarate reductase, iron-sulfur protein
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP2841: fumarate reductase, iron-sulfur protein
 
Vibrio shilonii AK1

Gene: VSAK1_11293: fumarate reductase, iron-sulfur protein
 
Vibrio splendidus LGP32

Gene: VS_0247: fumarate reductase, iron-sulfur protein
 
Vibrio fischeri ES114

Gene: VF_2335: fumarate reductase, iron-sulfur protein
 
Vibrio salmonicida LFI1238

Gene: VSAL_I2789: fumarate reductase, iron-sulfur protein
 
Vibrio angustum S14

Gene: VAS14_18901: fumarate reductase, iron-sulfur protein
 
Photobacterium profundum SS9

Gene: PBPRA3379: fumarate reductase, iron-sulfur protein
fumarate reductase, iron-sulfur protein
frdC
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC2658: fumarate reductase, 15 kDa hydrophobic protein
 
Vibrio vulnificus CMCP6

Gene: VV1_1267: fumarate reductase, 15 kDa hydrophobic protein
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_00133: fumarate reductase, 15 kDa hydrophobic protein
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP2842: fumarate reductase, 15 kDa hydrophobic protein
 
Vibrio shilonii AK1

Gene: VSAK1_11288: fumarate reductase, 15 kDa hydrophobic protein
 
Vibrio splendidus LGP32

Gene: VS_0246: fumarate reductase, 15 kDa hydrophobic protein
 
Vibrio fischeri ES114

Gene: VF_2336: fumarate reductase, 15 kDa hydrophobic protein
 
Vibrio salmonicida LFI1238

Gene: VSAL_I2790: fumarate reductase, 15 kDa hydrophobic protein
 
Vibrio angustum S14

Gene: VAS14_18906: fumarate reductase, 15 kDa hydrophobic protein
 
Photobacterium profundum SS9

Gene: PBPRA3380: fumarate reductase, 15 kDa hydrophobic protein
fumarate reductase, 15 kDa hydrophobic protein
frdD
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC2659: fumarate reductase, 13 kDa hydrophobic protein
 
Vibrio vulnificus CMCP6

Gene: VV1_1266: fumarate reductase, 13 kDa hydrophobic protein
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_00134: fumarate reductase, 13 kDa hydrophobic protein
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP2843: fumarate reductase, 13 kDa hydrophobic protein
 
Vibrio shilonii AK1

Gene: VSAK1_11283: fumarate reductase, 13 kDa hydrophobic protein
 
Vibrio splendidus LGP32

Gene: VS_0245: fumarate reductase, 13 kDa hydrophobic protein
 
Vibrio fischeri ES114

Gene: VF_2337: fumarate reductase, 13 kDa hydrophobic protein
 
Vibrio salmonicida LFI1238

Gene: VSAL_I2791: fumarate reductase, 13 kDa hydrophobic protein
 
Vibrio angustum S14

Gene: VAS14_18911: fumarate reductase, 13 kDa hydrophobic protein
 
Photobacterium profundum SS9

Gene: PBPRA3381: fumarate reductase, 13 kDa hydrophobic protein
fumarate reductase, 13 kDa hydrophobic protein
 
CRON 49.
azu1
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
*
Vibrio splendidus LGP32

Site:
position = -27
score = 5.30742
sequence = TGTTGAAAATAATTCTTATTT

Gene: VS_II0661: Pseudoazurin (blue copper protein)
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Pseudoazurin (blue copper protein)
 
CRON 50.
VPA1658
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -208
score = 5.54018
sequence = AAATAAGAACAAATATTATTT

Gene: VPA1658: Vibrioferrin ligase/carboxylase protein PvsA
 
Vibrio shilonii AK1
*
Vibrio splendidus LGP32

Site:
position = -211
score = 5.35018
sequence = GAATAAGAACAAATATCATTT

Gene: VS_II1129: Vibrioferrin ligase/carboxylase protein PvsA
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Vibrioferrin ligase/carboxylase protein PvsA
VPA1659
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA1659: Vibrioferrin amide bond forming protein PvsB @ Siderophore synthetase superfamily, group B
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_II1130: Vibrioferrin amide bond forming protein PvsB @ Siderophore synthetase superfamily, group B
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Vibrioferrin amide bond forming protein PvsB @ Siderophore synthetase superfamily, group B
VPA1660
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA1660: Vibrioferrin membrane-spanning transport protein PvsC
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_II1131: Vibrioferrin membrane-spanning transport protein PvsC
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Vibrioferrin membrane-spanning transport protein PvsC
VPA1661
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA1661: Vibrioferrin amide bond forming protein PvsD @ Siderophore synthetase superfamily, group A
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_II1132: Vibrioferrin amide bond forming protein PvsD @ Siderophore synthetase superfamily, group A
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Vibrioferrin amide bond forming protein PvsD @ Siderophore synthetase superfamily, group A
VPA1662
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA1662: Vibrioferrin decarboxylase protein PvsE
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_II1133: Vibrioferrin decarboxylase protein PvsE
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Vibrioferrin decarboxylase protein PvsE
 
CRON 51.
VC0074
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -29
score = 4.46852
sequence = GTCTGAGAATAATTCGTATTT

Gene: VC0074: conserved hypothetical protein
*
Vibrio vulnificus CMCP6

Site:
position = -66
score = 5.18933
sequence = AACTAAGAATTATTATTATTC

Gene: VV1_1113: conserved hypothetical protein
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -78
score = 5.47783
sequence = AACTAAGAATTATTATTATTA

Gene: VIBHAR_00530: conserved hypothetical protein
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -66
score = 5.57197
sequence = AACTAAGAATTATTATTATTT

Gene: VP0074: conserved hypothetical protein
*
Vibrio shilonii AK1

Site:
position = -47
score = 4.52152
sequence = AACTAAGAATCATTCCTGTTT

Gene: VSAK1_12905: conserved hypothetical protein
*
Vibrio splendidus LGP32

Site:
position = -38
score = 5.09213
sequence = AACTAAGAATCATTATTATTC

Gene: VS_0088: conserved hypothetical protein
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
*
Vibrio angustum S14

Site:
position = -62
score = 5.17428
sequence = AATTACGAATCATTATCGTTT

Gene: VAS14_22809: conserved hypothetical protein
*
Photobacterium profundum SS9

Site:
position = -19
score = 5.19297
sequence = AACTGATAATGATTAGCGTTT

Gene: PBPRA3532: conserved hypothetical protein
conserved hypothetical protein
 
CRON 52.
VSAK1_26775
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
*
Vibrio shilonii AK1

Site:
position = -52
score = 5.4723
sequence = AAATGAAAGTAATTATCAATA

Site:
position = -46
score = 4.44498
sequence = AAGTAATTATCAATAACATTT

Gene: VSAK1_26775: ferrichrome-iron receptor
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
ferrichrome-iron receptor
VSAK1_26770
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1

Gene: VSAK1_26770: ferrichrome-iron receptor
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
ferrichrome-iron receptor
VSAK1_26765
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1

Gene: VSAK1_26765: hypothetical protein
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
hypothetical protein
 
CRON 53.
VC0774
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -97
score = 5.66493
sequence = AAATGAGAATAGTTTTTATTA

Site:
position = -74
score = 4.6574
sequence = AAATGCAAGCAATTTCCATTT

Gene: VC0774: 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (EC 1.3.1.28) # Vibriobactin-specific, VibA
*
Vibrio vulnificus CMCP6

Site:
position = -122
score = 5.79037
sequence = TAACGATAATAATTATCATTA

Site:
position = -128
score = 4.70318
sequence = AAATGCTAACGATAATAATTA

Gene: VV20834: 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (EC 1.3.1.28) # Vibriobactin-specific, VibA
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_01396: 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (EC 1.3.1.28) # Vibriobactin-specific, VibA
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRB1820: 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (EC 1.3.1.28) # Vibriobactin-specific, VibA
2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (EC 1.3.1.28) # Vibriobactin-specific, VibA
 
CRON 54.
viuA
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -290
score = 4.96512
sequence = AAATGAGAATGCTTTACATTT

Gene: VC2211: Ferric aerobactin receptor, TonB-dependent
*
Vibrio vulnificus CMCP6

Site:
position = -299
score = 4.96512
sequence = AAATGAGAATGCTTTACATTT

Gene: VV20843: Ferric aerobactin receptor, TonB-dependent
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -134
score = 5.18994
sequence = AAATGATAATTATTGATATTT

Gene: VIBHAR_01762: Ferric aerobactin receptor, TonB-dependent
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_1121: Ferric aerobactin receptor, TonB-dependent
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Ferric aerobactin receptor, TonB-dependent
 
CRON 55.
VSAK1_18187
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
*
Vibrio shilonii AK1

Site:
position = -64
score = 5.61338
sequence = TAATGACAATAGTTATCATTA

Gene: VSAK1_18187: TonB-dependent receptor
*
Vibrio splendidus LGP32

Site:
position = -46
score = 5.49178
sequence = TAATGCAAACCATTATCATTA

Site:
position = -17
score = 4.88516
sequence = ATATAAGAATAAATATCATGT

Gene: VS_1633: TonB-dependent receptor
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
TonB-dependent receptor
 
CRON 56.
fecB
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
*
Photobacterium profundum SS9

Site:
position = -69
score = 5.31972
sequence = AAATAAAAATAGTTATCAATC

Gene: PBPRB1817: Iron(III) dicitrate transport system, periplasmic iron-binding protein FecB (TC 3.A.1.14.1)
Iron(III) dicitrate transport system, periplasmic iron-binding protein FecB (TC 3.A.1.14.1)
 
CRON 57.
VIBHAR_06301
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -2
score = 4.93973
sequence = AAATGAGAATTAGTTTCGTTA

Gene: VIBHAR_06301: hypothetical protein
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
hypothetical protein
VV21338
 
Vibrio cholerae O1 biovar eltor str. N16961
*
Vibrio vulnificus CMCP6

Site:
position = -154
score = 5.50324
sequence = AAATGATAACCATTCTCTTTT

Gene: VV21338: HTH-type transcription regulator, AraC-family
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06300: HTH-type transcription regulator, AraC-family
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1

Gene: VSAK1_26780: HTH-type transcription regulator, AraC-family
*
Vibrio splendidus LGP32

Site:
position = -244
score = 4.57362
sequence = AAATGAGAATCAGTTGCGTTA

Gene: VS_II0500: HTH-type transcription regulator, AraC-family
 
Vibrio fischeri ES114

Gene: VF_A0785: HTH-type transcription regulator, AraC-family
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0910: HTH-type transcription regulator, AraC-family
 
Vibrio angustum S14
 
Photobacterium profundum SS9
HTH-type transcription regulator, AraC-family
 
CRON 58.
vibH
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -214
score = 4.79459
sequence = AAATAAAAATGTTTTTCATTG

Site:
position = -196
score = 4.87378
sequence = TTGTAATATTGATTCTCATTT

Gene: VC0775: Amide synthase component of siderophore synthetase # Vibriobactin-specific, VibH
*
Vibrio vulnificus CMCP6

Site:
position = -79
score = 5.6077
sequence = AATTGATAACTATTATCATTG

Gene: VV20844: Amide synthase component of siderophore synthetase # Vibriobactin-specific, VibH
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Amide synthase component of siderophore synthetase # Vibriobactin-specific, VibH
 
CRON 59.
VCA0576
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -60
score = 5.67749
sequence = AAATGATAGCAATTATCATTA

Gene: VCA0576: TonB-dependent heme and hemoglobin receptor HutA; TonB-dependent hemin , ferrichrome receptor
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
TonB-dependent heme and hemoglobin receptor HutA; TonB-dependent hemin , ferrichrome receptor
 
CRON 60.
VPA1434
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -109
score = 5.45153
sequence = TAATTGTAATTATTATCATTT

Gene: VPA1434: putative hemolysin secretion ATP-binding protein
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
*
Photobacterium profundum SS9

Site:
position = -160
score = 5.40397
sequence = TAATGATAATGATTGTCATCT

Gene: PBPRA1567: putative hemolysin secretion ATP-binding protein
putative hemolysin secretion ATP-binding protein
 
CRON 61.
VSAK1_16967
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
*
Vibrio shilonii AK1

Site:
position = -42
score = 4.82343
sequence = TATTAATAATAAAACTTATTA

Gene: VSAK1_16967: outer membrane protein OmpU
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
*
Vibrio angustum S14

Site:
position = -74
score = 5.34295
sequence = TAATGATTACCATTCTCATTA

Gene: VAS14_08970: outer membrane protein OmpU
 
Photobacterium profundum SS9
outer membrane protein OmpU
 
CRON 62.
ppaC
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -143
score = 5.1337
sequence = AGTTGAGAACTATTCGCAATT

Gene: VC1687: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)
*
Vibrio vulnificus CMCP6

Site:
position = -163
score = 5.99285
sequence = AAATAAGAATGATTATCATTA

Site:
position = -137
score = 5.46499
sequence = AAGTGAGAATTATTCGCAATA

Gene: VV1_2888: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -191
score = 5.91653
sequence = AAATGGTAATAATTCTCATTA

Site:
position = -165
score = 5.46499
sequence = AAGTGAGAATTATTCGCAATA

Gene: VIBHAR_01860: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)
*2
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -185
score = 4.4636
sequence = AAATGCAAATGGTAATAATTA

Site:
position = -179
score = 6.01099
sequence = AAATGGTAATAATTATCATTA

Site:
position = -153
score = 5.50235
sequence = AAATGAGATTTATTCGCAATA

Gene: VP1165: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)

Gene: VP1770: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)
*
Vibrio shilonii AK1

Site:
position = -192
score = 6.28269
sequence = AAATGAGAATTATTATCATTA

Site:
position = -166
score = 5.05425
sequence = ATATGAGAATAATTCTCAATG

Gene: VSAK1_04387: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)
*
Vibrio splendidus LGP32

Site:
position = -161
score = 5.93749
sequence = GAATGATAATAATTATCAATT

Site:
position = -155
score = 4.3675
sequence = TAATAATTATCAATTGCATTC

Gene: VS_2001: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)
 
Vibrio fischeri ES114

Gene: VF_A0421: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0738: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)
 
Vibrio angustum S14

Gene: VAS14_03748: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)
 2
Photobacterium profundum SS9

Gene: PBPRB1355: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)

Gene: PBPRA1513: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)
Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)
 
CRON 63.
VAS14_13349
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
*
Vibrio angustum S14

Site:
position = -116
score = 4.56304
sequence = ATATAGTAATAAGTCTCATTA

Site:
position = -53
score = 5.79037
sequence = TAACGATAATTATTATCATTA

Site:
position = -47
score = 4.965
sequence = TAATTATTATCATTATTATTT

Gene: VAS14_13349: Periplasmic binding protein
 
Photobacterium profundum SS9
Periplasmic binding protein
fecD
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14

Gene: VAS14_13354: Iron(III) dicitrate transport system permease protein FecD (TC 3.A.1.14.1)
 
Photobacterium profundum SS9

Gene: PBPRB1385: Iron(III) dicitrate transport system permease protein FecD (TC 3.A.1.14.1)
Iron(III) dicitrate transport system permease protein FecD (TC 3.A.1.14.1)
fecE
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14

Gene: VAS14_13359: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)
 
Photobacterium profundum SS9

Gene: PBPRB1384: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)
Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)
 
CRON 64.
iscA
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
*
Vibrio splendidus LGP32

Site:
position = -102
score = 4.50736
sequence = ATATGCAAATGATAATCAATA

Site:
position = -96
score = 5.71637
sequence = AAATGATAATCAATATCATCT

Site:
position = -207
score = 5.84201
sequence = TAATGATAATCATTATTAATA

Gene: VS_1901: Iron binding protein IscA for iron-sulfur cluster assembly
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Iron binding protein IscA for iron-sulfur cluster assembly
sufB
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_1902: Iron-sulfur cluster assembly protein SufB
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Iron-sulfur cluster assembly protein SufB
sufC
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_1903: Iron-sulfur cluster assembly ATPase protein SufC
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Iron-sulfur cluster assembly ATPase protein SufC
sufD
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_1904: Iron-sulfur cluster assembly protein SufD
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Iron-sulfur cluster assembly protein SufD
sufS
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_1905: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
sufE
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_1906: Sulfur acceptor protein SufE for iron-sulfur cluster assembly
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Sulfur acceptor protein SufE for iron-sulfur cluster assembly
 
CRON 65.
VV21178
 
Vibrio cholerae O1 biovar eltor str. N16961
*
Vibrio vulnificus CMCP6

Site:
position = -41
score = 6.37715
sequence = AAATGATAATAATTATCATTA

Site:
position = -38
score = 4.36211
sequence = TGATAATAATTATCATTATAT

Gene: VV21178: ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -46
score = 5.02391
sequence = TAATGATAATGATAATGATTA

Site:
position = -40
score = 5.6891
sequence = TAATGATAATGATTATCTTTT

Gene: VIBHAR_07043: ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -2
score = 5.7863
sequence = TAATGATAATAATTATCTTTT

Gene: VPA0004: ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component
 
Vibrio shilonii AK1
*
Vibrio splendidus LGP32

Site:
position = -31
score = 5.9463
sequence = TAATGATAATAGTTATCAATA

Gene: VS_II1528: ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component
*
Vibrio fischeri ES114

Site:
position = -44
score = 5.03841
sequence = TGATAATAATGATAATCATTA

Site:
position = -38
score = 5.30646
sequence = TAATGATAATCATTATCTTTC

Gene: VF_A0200: ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component
 
Vibrio salmonicida LFI1238
*
Vibrio angustum S14

Site:
position = -53
score = 5.43268
sequence = TAATGATAATAAGTTTCATTA

Site:
position = -47
score = 4.68106
sequence = TAATAAGTTTCATTATCATGT

Gene: VAS14_10859: ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component
 
Photobacterium profundum SS9
ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component
VV21177
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6

Gene: VV21177: ABC-type oligopeptide transport system, ATPase component
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0003: ABC-type oligopeptide transport system, ATPase component
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_II1529: ABC-type oligopeptide transport system, ATPase component
 
Vibrio fischeri ES114

Gene: VF_A0199: ABC-type oligopeptide transport system, ATPase component
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14

Gene: VAS14_10854: ABC-type oligopeptide transport system, ATPase component
 
Photobacterium profundum SS9
ABC-type oligopeptide transport system, ATPase component
VCA0003
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0003: Conesrved hypothetical protein
 
Vibrio vulnificus CMCP6

Gene: VV21176: Conesrved hypothetical protein
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_07045: Conesrved hypothetical protein
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0002: Conesrved hypothetical protein
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_II1530: Conesrved hypothetical protein
 
Vibrio fischeri ES114

Gene: VF_A0198: Conesrved hypothetical protein
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0169: Conesrved hypothetical protein
 
Vibrio angustum S14

Gene: VAS14_10849: Conesrved hypothetical protein
 
Photobacterium profundum SS9

Gene: PBPRB0792: Conesrved hypothetical protein
Conesrved hypothetical protein
 
CRON 66.
COG3016
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC2004: Conserved hypothetical iron-regulated protein
*
Vibrio vulnificus CMCP6

Site:
position = -114
score = 5.50325
sequence = TAAAGAGAATTATTCTCATTA

Gene: VV1_2020: Conserved hypothetical iron-regulated protein
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -80
score = 5.42701
sequence = TAACGCTAATTATTCTCATTA

Gene: VIBHAR_03054: Conserved hypothetical iron-regulated protein
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -80
score = 5.45329
sequence = TAACGAAAATCATTCTCATTT

Gene: VP2161: Conserved hypothetical iron-regulated protein
 
Vibrio shilonii AK1

Gene: VSAK1_10043: Conserved hypothetical iron-regulated protein
 
Vibrio splendidus LGP32

Gene: VS_0927: Conserved hypothetical iron-regulated protein
*
Vibrio fischeri ES114

Site:
position = -82
score = 5.47882
sequence = TACTGAGAATGATTCTTATTT

Site:
position = -66
score = 4.74066
sequence = TATTTATATTGATAATCATTT

Site:
position = -60
score = 5.52305
sequence = TATTGATAATCATTTCCATTT

Gene: VF_A0756: Conserved hypothetical iron-regulated protein
*
Vibrio salmonicida LFI1238

Site:
position = -82
score = 5.17808
sequence = AGTTGATAATGATTACTATTA

Gene: VSAL_II0868: Conserved hypothetical iron-regulated protein
*
Vibrio angustum S14

Site:
position = -93
score = 5.15586
sequence = AATTGATAATAACTCGTATTA

Gene: VAS14_06553: Conserved hypothetical iron-regulated protein
*
Photobacterium profundum SS9

Site:
position = -190
score = 5.4434
sequence = TATTGATATTGATTATCAGTT

Site:
position = -167
score = 4.86396
sequence = ATTTGATAATCAATATCAACT

Gene: PBPRA2792: Conserved hypothetical iron-regulated protein
Conserved hypothetical iron-regulated protein
 
CRON 67.
VC0877
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = 20
score = 4.87186
sequence = AATTAATAATTATTCTCAAGG

Gene: VC0877: hypothetical protein
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
hypothetical protein
yaeB
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC0876: conserved hypothetical protein
 
Vibrio vulnificus CMCP6
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -81
score = 5.14044
sequence = AATTAATAATCATTCTCAAAA

Gene: VIBHAR_03251: hypothetical protein
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -81
score = 5.32437
sequence = AATTAATAATCATTCCCAATA

Gene: VP2332: conserved hypothetical protein
 
Vibrio shilonii AK1

Gene: VSAK1_11800: hypothetical protein
*
Vibrio splendidus LGP32

Site:
position = -81
score = 5.6759
sequence = AAATGATAATTATTATCAAAA

Gene: VS_2367: transcriptional regulator
 
Vibrio fischeri ES114

Gene: VF_0683: hypothetical protein
*
Vibrio salmonicida LFI1238

Site:
position = -89
score = 5.22112
sequence = AATTGCGAACTATTATCATAT

Gene: VSAL_I0891: hypothetical protein
 
Vibrio angustum S14

Gene: VAS14_21071: hypothetical protein
 
Photobacterium profundum SS9

Gene: PBPRA2943: conserved hypothetical protein
conserved hypothetical protein
 
CRON 68.
ptrB
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -76
score = 5.73282
sequence = AAATGATAATTGATCTTATTT

Gene: VCA0063: Protease II (EC 3.4.21.83)
*
Vibrio vulnificus CMCP6

Site:
position = -155
score = 5.77431
sequence = AATTGATATCTATTCTCATTT

Site:
position = -103
score = 5.3432
sequence = AAATGATAATTGATGTTATTT

Gene: VV21548: Protease II (EC 3.4.21.83)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -80
score = 5.92547
sequence = AAATGATAATTGATCTCATTT

Gene: VIBHAR_05127: Protease II (EC 3.4.21.83)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -79
score = 5.92547
sequence = AAATGATAATTGATCTCATTT

Gene: VPA1467: Protease II (EC 3.4.21.83)
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
*
Vibrio fischeri ES114

Site:
position = -85
score = 4.35258
sequence = AAATGAAAATGATAATTGATC

Site:
position = -79
score = 5.54283
sequence = AAATGATAATTGATCTCATTC

Gene: VF_A0333: Protease II (EC 3.4.21.83)
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
*
Photobacterium profundum SS9

Site:
position = -73
score = 4.9661
sequence = AAATGAGAATCATTCTTGATC

Gene: PBPRB0979: Protease II (EC 3.4.21.83)
Protease II (EC 3.4.21.83)
hutR
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0064: TonB-dependent heme receptor HutR
 
Vibrio vulnificus CMCP6

Gene: VV21549: TonB-dependent heme receptor HutR
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_05128: TonB-dependent heme receptor HutR
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA1466: TonB-dependent heme receptor HutR
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114

Gene: VF_A0332: TonB-dependent heme receptor HutR
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRB0978: TonB-dependent heme receptor HutR
TonB-dependent heme receptor HutR
VIBHAR_03587
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_05129: hypothetical protein
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
hypothetical protein
VIBHAR_05130
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_05130: hypothetical protein
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
hypothetical protein
VCA0065
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0065: Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase
 
Vibrio vulnificus CMCP6

Gene: VV21550: Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase
 2
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_05131: Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase

Gene: VIBHAR_05132: Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA1465: Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114

Gene: VF_A0331: Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRB0977: Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase
Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase
VCA0066
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0066: Hypothetical protein in cluster with HutR, VCA0066 homolog
 
Vibrio vulnificus CMCP6

Gene: VV21551: Hypothetical protein in cluster with HutR, VCA0066 homolog
 2
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_05133: Hypothetical protein in cluster with HutR, VCA0066 homolog

Gene: VIBHAR_05134: Hypothetical protein in cluster with HutR, VCA0066 homolog
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA1464: Hypothetical protein in cluster with HutR, VCA0066 homolog
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114

Gene: VF_A0330: Hypothetical protein in cluster with HutR, VCA0066 homolog
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRB0976: Hypothetical protein in cluster with HutR, VCA0066 homolog
Hypothetical protein in cluster with HutR, VCA0066 homolog
VCA0067
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0067: Hypothetical protein in cluster with HutR, VCA0067 homolog
 
Vibrio vulnificus CMCP6

Gene: VV21552: Hypothetical protein in cluster with HutR, VCA0067 homolog
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_05135: Hypothetical protein in cluster with HutR, VCA0067 homolog
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA1463: Hypothetical protein in cluster with HutR, VCA0067 homolog
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114

Gene: VF_A0329: Hypothetical protein in cluster with HutR, VCA0067 homolog
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Hypothetical protein in cluster with HutR, VCA0067 homolog
PBPRB0975
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRB0975: hypothetical protein
hypothetical protein
 
CRON 69.
vctP
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
*
Vibrio fischeri ES114

Site:
position = -65
score = 5.56805
sequence = TAATAATAACCATTTTCATTA

Site:
position = -34
score = 5.42656
sequence = AAATACGAATAGTTATCACTT

Gene: VF_A0827: ferric anguibactin-binding protein
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
iron(III) ABC transporter, periplasmic iron-compound-binding protein
vctD
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114

Gene: VF_A0826: ferric anguibactin transport system permease protein FatD
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
iron(III) ABC transporter, permease protein
VCA0229
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114

Gene: VF_A0825: ferric anguibactin transport system permease protein FatC
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
iron(III) ABC transporter, permease protein
vctC
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114

Gene: VF_A0824: ferric anguibactin transport ATP-binding protein
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
iron(III) ABC transporter, ATP-binding protein
VIBHAR_06920
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
*
Vibrio harveyi ATCC BAA-1116

Site:
position = 4
score = 4.42241
sequence = GAAAGAGAATTGTTATCAAAA

Gene: VIBHAR_06920: Siderophore-interacting protein ViuB
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0089: Siderophore-interacting protein ViuB
*
Vibrio shilonii AK1

Site:
position = -31
score = 5.38917
sequence = AAATGAAAACAATAATCATTA

Gene: VSAK1_05955: Siderophore-interacting protein ViuB
*
Vibrio splendidus LGP32

Site:
position = -76
score = 5.2973
sequence = AAATGATAACTATTAGTATTG

Gene: VS_II0412: Siderophore-interacting protein ViuB
 
Vibrio fischeri ES114

Gene: VF_A0823: Siderophore-interacting protein ViuB
 
Vibrio salmonicida LFI1238
*
Vibrio angustum S14

Site:
position = -29
score = 5.51071
sequence = AAATAAAAACCATTCTCAATT

Gene: VAS14_04423: Siderophore-interacting protein ViuB
 
Photobacterium profundum SS9
Siderophore-interacting protein ViuB
 
CRON 70.
nrfB
 
Vibrio cholerae O1 biovar eltor str. N16961
*
Vibrio vulnificus CMCP6

Site:
position = -144
score = 5.24875
sequence = AAATAAGAATTGATGTCATTT

Site:
position = -76
score = 5.5451
sequence = AATTGAAAATGATTCTTAATT

Gene: VV1_3034: Cytochrome c-type protein NrfB precursor
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -118
score = 5.24875
sequence = AAATAAGAATTGATGTCATTT

Site:
position = -46
score = 5.88896
sequence = AATTGAGAATAGTTATCAATT

Gene: VIBHAR_02726: Cytochrome c-type protein NrfB precursor
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -140
score = 5.24875
sequence = AAATAAGAATTGATGTCATTT

Site:
position = -70
score = 5.31152
sequence = AGTTGAGAACAGTTATCAATT

Gene: VP1928: Cytochrome c-type protein NrfB precursor
*
Vibrio shilonii AK1

Site:
position = -274
score = 5.71943
sequence = TGATGATATTAATTATCATTT

Site:
position = -125
score = 4.88862
sequence = AAATAAGAATTGATTACATTT

Gene: VSAK1_05595: Cytochrome c-type protein NrfB precursor
*
Vibrio splendidus LGP32

Site:
position = -263
score = 5.40717
sequence = AACTGAGAATTATTATCATAT

Site:
position = -113
score = 5.73282
sequence = AAATAAGAATTGATATCATTT

Gene: VS_1932: Cytochrome c-type protein NrfB precursor
*
Vibrio fischeri ES114

Site:
position = -264
score = 5.5546
sequence = TATTAAGAATGATTCTTATTT

Gene: VF_1553: Cytochrome c-type protein NrfB precursor
*
Vibrio salmonicida LFI1238

Site:
position = -286
score = 5.4635
sequence = TATTAATAATGGTTCTTATTT

Site:
position = -127
score = 4.48097
sequence = CAATGAGAATTGATTTCAATG

Gene: VSAL_I1998: Cytochrome c-type protein NrfB precursor
 
Vibrio angustum S14
*
Photobacterium profundum SS9

Site:
position = -208
score = 4.75395
sequence = TAATGAGAATGGGTGTCAATT

Site:
position = -191
score = 5.09667
sequence = AATTGCAAATGGTTTTTATTT

Gene: PBPRA1259: Cytochrome c-type protein NrfB precursor
Cytochrome c-type protein NrfB precursor
nfrC
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6

Gene: VV1_3033: Putative nitrite reductase, Fe-S protein (NrfC)
 2
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_02725: Putative nitrite reductase, Fe-S protein (NrfC)

Gene: VIBHAR_02724: Putative nitrite reductase, Fe-S protein (NrfC)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP1927: Putative nitrite reductase, Fe-S protein (NrfC)
 
Vibrio shilonii AK1

Gene: VSAK1_05590: Putative nitrite reductase, Fe-S protein (NrfC)
 
Vibrio splendidus LGP32

Gene: VS_1931: Putative nitrite reductase, Fe-S protein (NrfC)
 
Vibrio fischeri ES114

Gene: VF_1552: Putative nitrite reductase, Fe-S protein (NrfC)
 
Vibrio salmonicida LFI1238

Gene: VSAL_I1999: Putative nitrite reductase, Fe-S protein (NrfC)
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRA1260: Putative nitrite reductase, Fe-S protein (NrfC)
Putative nitrite reductase, Fe-S protein (NrfC)
nrfD
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6

Gene: VV1_3032: Putative nitrate reductase, formate dependent (NrfD)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_02723: Putative nitrate reductase, formate dependent (NrfD)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP1926: Putative nitrate reductase, formate dependent (NrfD)
 
Vibrio shilonii AK1

Gene: VSAK1_05585: Putative nitrate reductase, formate dependent (NrfD)
 
Vibrio splendidus LGP32

Gene: VS_1930: Putative nitrate reductase, formate dependent (NrfD)
 
Vibrio fischeri ES114

Gene: VF_1551: Putative nitrate reductase, formate dependent (NrfD)
 
Vibrio salmonicida LFI1238

Gene: VSAL_I2000: Putative nitrate reductase, formate dependent (NrfD)
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRA1261: Putative nitrate reductase, formate dependent (NrfD)
Putative nitrate reductase, formate dependent (NrfD)
 
CRON 71.
tonB-hmu
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -170
score = 5.33368
sequence = AATTGATAATTGCTATTATTA

Gene: VCA0910: Periplasmic protein TonB involved in hemin uptake
*
Vibrio vulnificus CMCP6

Site:
position = -115
score = 5.58166
sequence = AATTGATAATTGATCTTATTT

Gene: VV21614: Periplasmic protein TonB involved in hemin uptake
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -79
score = 5.58166
sequence = AATTGATAATTGATCTTATTT

Site:
position = -34
score = 5.31682
sequence = AGTTGATAATGATTAGCAATA

Gene: VIBHAR_05244: Periplasmic protein TonB involved in hemin uptake
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -74
score = 5.58166
sequence = AATTGATAATTGATCTTATTT

Gene: VPA0426: Periplasmic protein TonB involved in hemin uptake
*2
Vibrio shilonii AK1

Site:
position = -78
score = 5.58166
sequence = AATTGATAATTGATCTTATTT

Gene: VSAK1_22229: Periplasmic protein TonB involved in hemin uptake

Gene: VSAK1_22224: Periplasmic protein TonB involved in hemin uptake
*
Vibrio splendidus LGP32

Site:
position = -67
score = 5.58166
sequence = AATTGATAATTGATCTTATTT

Gene: VS_II0289: Periplasmic protein TonB involved in hemin uptake
*
Vibrio fischeri ES114

Site:
position = -65
score = 5.68017
sequence = AATTGATAATTGATCTCATTA

Gene: VF_1225: Periplasmic protein TonB involved in hemin uptake
 
Vibrio salmonicida LFI1238
*
Vibrio angustum S14

Site:
position = -190
score = 5.44464
sequence = AAATGATAATTGATATTATTC

Gene: VAS14_03958: Periplasmic protein TonB involved in hemin uptake
*
Photobacterium profundum SS9

Site:
position = -196
score = 5.82117
sequence = AAATGATAATCAATCTTATTT

Site:
position = -141
score = 5.44464
sequence = AAATGATAATTGATATTATTC

Gene: PBPRA2103: Periplasmic protein TonB involved in hemin uptake
Periplasmic protein TonB involved in hemin uptake
exbB-hmu
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0911: TonB system transport protein ExbB involved in hemin uptake
 
Vibrio vulnificus CMCP6

Gene: VV21613: TonB system transport protein ExbB involved in hemin uptake
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_05243: TonB system transport protein ExbB involved in hemin uptake
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0425: TonB system transport protein ExbB involved in hemin uptake
 
Vibrio shilonii AK1

Gene: VSAK1_22219: TonB system transport protein ExbB involved in hemin uptake
 
Vibrio splendidus LGP32

Gene: VS_II0288: TonB system transport protein ExbB involved in hemin uptake
 
Vibrio fischeri ES114

Gene: VF_1224: TonB system transport protein ExbB involved in hemin uptake
 
Vibrio salmonicida LFI1238

Gene: VSAL_I1752: TonB system transport protein ExbB involved in hemin uptake
 
Vibrio angustum S14

Gene: VAS14_03963: TonB system transport protein ExbB involved in hemin uptake
 
Photobacterium profundum SS9

Gene: PBPRA2104: TonB system transport protein ExbB involved in hemin uptake
TonB system transport protein ExbB involved in hemin uptake
exbD-hmu
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0912: TonB system transport protein ExbD involved in hemin uptake
 
Vibrio vulnificus CMCP6

Gene: VV21612: TonB system transport protein ExbD involved in hemin uptake
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_05242: TonB system transport protein ExbD involved in hemin uptake
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0424: TonB system transport protein ExbD involved in hemin uptake
 
Vibrio shilonii AK1

Gene: VSAK1_22214: TonB system transport protein ExbD involved in hemin uptake
 
Vibrio splendidus LGP32

Gene: VS_II0287: TonB system transport protein ExbD involved in hemin uptake
 
Vibrio fischeri ES114

Gene: VF_1223: TonB system transport protein ExbD involved in hemin uptake
 
Vibrio salmonicida LFI1238

Gene: VSAL_I1753: TonB system transport protein ExbD involved in hemin uptake
 
Vibrio angustum S14

Gene: VAS14_03968: TonB system transport protein ExbD involved in hemin uptake
 
Photobacterium profundum SS9

Gene: PBPRA2105: TonB system transport protein ExbD involved in hemin uptake
TonB system transport protein ExbD involved in hemin uptake
hmuT
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0913: Hemin ABC transporter, periplasmic hemin-binding protein
 
Vibrio vulnificus CMCP6

Gene: VV21611: Hemin ABC transporter, periplasmic hemin-binding protein
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_05241: Hemin ABC transporter, periplasmic hemin-binding protein
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0423: Hemin ABC transporter, periplasmic hemin-binding protein
 
Vibrio shilonii AK1

Gene: VSAK1_22209: Hemin ABC transporter, periplasmic hemin-binding protein
 
Vibrio splendidus LGP32

Gene: VS_II0286: Hemin ABC transporter, periplasmic hemin-binding protein
 
Vibrio fischeri ES114

Gene: VF_1222: Hemin ABC transporter, periplasmic hemin-binding protein
 
Vibrio salmonicida LFI1238

Gene: VSAL_I1754: Hemin ABC transporter, periplasmic hemin-binding protein
 
Vibrio angustum S14

Gene: VAS14_03973: Hemin ABC transporter, periplasmic hemin-binding protein
 
Photobacterium profundum SS9

Gene: PBPRA2106: Hemin ABC transporter, periplasmic hemin-binding protein
Hemin ABC transporter, periplasmic hemin-binding protein
hmuU
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0914: Hemin ABC transporter, permease component
 
Vibrio vulnificus CMCP6

Gene: VV21610: Hemin ABC transporter, permease component
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_05240: Hemin ABC transporter, permease component
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0422: Hemin ABC transporter, permease component
 
Vibrio shilonii AK1

Gene: VSAK1_22204: Hemin ABC transporter, permease component
 
Vibrio splendidus LGP32

Gene: VS_II0285: Hemin ABC transporter, permease component
 
Vibrio fischeri ES114

Gene: VF_1221: Hemin ABC transporter, permease component
 
Vibrio salmonicida LFI1238

Gene: VSAL_I1755: Hemin ABC transporter, permease component
 
Vibrio angustum S14

Gene: VAS14_03978: Hemin ABC transporter, permease component
 
Photobacterium profundum SS9

Gene: PBPRA2107: Hemin ABC transporter, permease component
Hemin ABC transporter, permease component
hmuV
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0915: Hemin ABC transporter, ATP-binding subunit
 
Vibrio vulnificus CMCP6

Gene: VV21609: Hemin ABC transporter, ATP-binding subunit
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_05239: Hemin ABC transporter, ATP-binding subunit
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0421: Hemin ABC transporter, ATP-binding subunit
 
Vibrio shilonii AK1

Gene: VSAK1_22199: Hemin ABC transporter, ATP-binding subunit
 
Vibrio splendidus LGP32

Gene: VS_II0284: Hemin ABC transporter, ATP-binding subunit
 
Vibrio fischeri ES114

Gene: VF_1220: Hemin ABC transporter, ATP-binding subunit
 
Vibrio salmonicida LFI1238

Gene: VSAL_I1756: Hemin ABC transporter, ATP-binding subunit
 
Vibrio angustum S14

Gene: VAS14_03983: Hemin ABC transporter, ATP-binding subunit
 
Photobacterium profundum SS9

Gene: PBPRA2108: Hemin ABC transporter, ATP-binding subunit
Hemin ABC transporter, ATP-binding subunit
 
CRON 72.
fhuE
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -97
score = 5.4355
sequence = AAATGGTAATAGTTGTCATTT

Gene: VIBHAR_06761: Putative ferrichrome-iron receptor
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -98
score = 5.33163
sequence = AAATGGTAATACTTATCACTT

Gene: VPA0150: Putative ferrichrome-iron receptor
 
Vibrio shilonii AK1
*
Vibrio splendidus LGP32

Site:
position = -124
score = 5.42376
sequence = AAATAGTAATAGTTATCACTT

Gene: VS_II0677: Putative ferrichrome-iron receptor
*
Vibrio fischeri ES114

Site:
position = -83
score = 5.91957
sequence = AAATGGTAACAATTATCATTT

Gene: VF_A0191: Putative ferrichrome-iron receptor
*
Vibrio salmonicida LFI1238

Site:
position = -82
score = 5.75632
sequence = AAATAAAAACGATTATCATTT

Gene: VSAL_II0110: Putative ferrichrome-iron receptor
*
Vibrio angustum S14

Site:
position = -189
score = 5.51921
sequence = AAATGGTAATGGTTATCACTT

Gene: VAS14_12509: Putative ferrichrome-iron receptor
*
Photobacterium profundum SS9

Site:
position = -160
score = 5.71365
sequence = AAATGCTAACAATTATCACTT

Gene: PBPRB1222: Putative ferrichrome-iron receptor
Putative ferrichrome-iron receptor
PF11932
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -58
score = 4.76526
sequence = TAATGAGAGCGTTTCTCAATA

Gene: VC1548: hypothetical protein
*
Vibrio vulnificus CMCP6

Site:
position = -58
score = 5.74796
sequence = TAATGCGAATAAATATCATTT

Gene: VV20364: hypothetical protein
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06760: hypothetical protein
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0151: hypothetical protein
*
Vibrio shilonii AK1

Site:
position = -225
score = 5.3043
sequence = AAATGATAACTCATATCAATA

Gene: VSAK1_26760: hypothetical protein
*
Vibrio splendidus LGP32

Site:
position = -61
score = 4.85912
sequence = TAATGAGACTGCTTATCAATA

Gene: VS_II0678: hypothetical protein
 
Vibrio fischeri ES114

Gene: VF_A0192: hypothetical protein
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0111: hypothetical protein
 
Vibrio angustum S14

Gene: VAS14_12504: hypothetical protein
*
Photobacterium profundum SS9

Site:
position = -98
score = 5.62308
sequence = AAATGAGATTCATTTTCAATT

Site:
position = -20
score = 4.44474
sequence = AAATACTATTGATGAGCAATA

Gene: PBPRB0694: hypothetical protein
hypothetical protein
exbB1
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1547: Biopolymer transport protein ExbB-related protein
 
Vibrio vulnificus CMCP6

Gene: VV20363: Biopolymer transport protein ExbB-related protein
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06759: Biopolymer transport protein ExbB-related protein
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0152: Biopolymer transport protein ExbB-related protein
 
Vibrio shilonii AK1

Gene: VSAK1_26755: Biopolymer transport protein ExbB-related protein
 
Vibrio splendidus LGP32

Gene: VS_II0679: Biopolymer transport protein ExbB-related protein
 
Vibrio fischeri ES114

Gene: VF_A0193: Biopolymer transport protein ExbB-related protein
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0112: Biopolymer transport protein ExbB-related protein
 
Vibrio angustum S14

Gene: VAS14_12499: Biopolymer transport protein ExbB-related protein
 
Photobacterium profundum SS9

Gene: PBPRB0695: Biopolymer transport protein ExbB-related protein
Biopolymer transport protein ExbB-related protein
exbB2
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1546: TonB system transport protein ExbB2
 
Vibrio vulnificus CMCP6

Gene: VV20362: TonB system transport protein ExbB2
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06758: TonB system transport protein ExbB2
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0153: TonB system transport protein ExbB2
 
Vibrio shilonii AK1

Gene: VSAK1_26750: TonB system transport protein ExbB2
 
Vibrio splendidus LGP32

Gene: VS_II0680: TonB system transport protein ExbB2
 
Vibrio fischeri ES114

Gene: VF_A0194: TonB system transport protein ExbB2
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0113: TonB system transport protein ExbB2
 
Vibrio angustum S14

Gene: VAS14_12494: TonB system transport protein ExbB2
 
Photobacterium profundum SS9

Gene: PBPRB0696: TonB system transport protein ExbB2
TonB system transport protein ExbB2
exbD2
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6

Gene: VV20361: TonB system transport protein ExbD2
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06757: TonB system transport protein ExbD2
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0154: TonB system transport protein ExbD2
 
Vibrio shilonii AK1

Gene: VSAK1_26745: TonB system transport protein ExbD2
 
Vibrio splendidus LGP32

Gene: VS_II0681: TonB system transport protein ExbD2
 
Vibrio fischeri ES114

Gene: VF_A0195: TonB system transport protein ExbD2
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0114: TonB system transport protein ExbD2
 
Vibrio angustum S14

Gene: VAS14_12489: TonB system transport protein ExbD2
 
Photobacterium profundum SS9

Gene: PBPRB0697: TonB system transport protein ExbD2
TonB system transport protein ExbD2
tonB
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1544: Periplasmic protein TonB
 
Vibrio vulnificus CMCP6

Gene: VV20360: Periplasmic protein TonB
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06756: Periplasmic protein TonB
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0155: Periplasmic protein TonB
 
Vibrio shilonii AK1

Gene: VSAK1_26740: Periplasmic protein TonB
 
Vibrio splendidus LGP32

Gene: VS_II0682: Periplasmic protein TonB
 
Vibrio fischeri ES114

Gene: VF_A0196: Periplasmic protein TonB
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0115: Periplasmic protein TonB
 
Vibrio angustum S14

Gene: VAS14_12484: Periplasmic protein TonB
 
Photobacterium profundum SS9

Gene: PBPRB0698: Periplasmic protein TonB
Periplasmic protein TonB
VC1543
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1543: TPR domain protein, putative component of TonB system
 
Vibrio vulnificus CMCP6

Gene: VV20359: TPR domain protein, putative component of TonB system
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06755: TPR domain protein, putative component of TonB system
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0156: TPR domain protein, putative component of TonB system
 
Vibrio shilonii AK1

Gene: VSAK1_26735: TPR domain protein, putative component of TonB system
 
Vibrio splendidus LGP32

Gene: VS_II0683: TPR domain protein, putative component of TonB system
 
Vibrio fischeri ES114

Gene: VF_A0197: TPR domain protein, putative component of TonB system
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0116: TPR domain protein, putative component of TonB system
 
Vibrio angustum S14

Gene: VAS14_12479: TPR domain protein, putative component of TonB system
 
Photobacterium profundum SS9

Gene: PBPRB0699: TPR domain protein, putative component of TonB system
TPR domain protein, putative component of TonB system
 
CRON 73.
feoA
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -242
score = 4.83329
sequence = AGATAATATTTATTCTGATTA

Site:
position = -42
score = 5.80368
sequence = AAATAATAATATTTATCATTA

Gene: VP0857: Ferrous iron transport protein A
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Ferrous iron transport protein A
 
CRON 74.
sitA
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
*
Vibrio angustum S14

Site:
position = -83
score = 4.75015
sequence = TAATAATTATCAATTGCATTT

Site:
position = -89
score = 6.07483
sequence = TATTGATAATAATTATCAATT

Gene: VAS14_10539: Manganese ABC transporter, periplasmic-binding protein SitA
 
Photobacterium profundum SS9
Manganese ABC transporter, periplasmic-binding protein SitA
sitB
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14

Gene: VAS14_10534: Manganese ABC transporter, ATP-binding protein SitB
 
Photobacterium profundum SS9
Manganese ABC transporter, ATP-binding protein SitB
sitC
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14

Gene: VAS14_10529: Manganese ABC transporter, inner membrane permease protein SitC
 
Photobacterium profundum SS9
Manganese ABC transporter, inner membrane permease protein SitC
sitD
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14

Gene: VAS14_10524: Manganese ABC transporter, inner membrane permease protein SitD
 
Photobacterium profundum SS9
Manganese ABC transporter, inner membrane permease protein SitD
 
CRON 75.
VV20568
 
Vibrio cholerae O1 biovar eltor str. N16961
*
Vibrio vulnificus CMCP6

Site:
position = -317
score = 6.20547
sequence = AAATGATAATAAATATCATTT

Gene: VV20568: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -197
score = 4.57184
sequence = CAATGTAAATGGTTCTCAATT

Gene: VIBHAR_06272: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -252
score = 5.00459
sequence = TAATGTAAATGGTTCTCAATT

Gene: VPA0536: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
 
Vibrio shilonii AK1

Gene: VSAK1_17012: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
 
Vibrio splendidus LGP32

Gene: VS_II0365: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14

Gene: VAS14_21827: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
 
Photobacterium profundum SS9

Gene: PBPRA0167: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
VV20567
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6

Gene: VV20567: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06271: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0537: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Vibrio shilonii AK1

Gene: VSAK1_17007: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Vibrio splendidus LGP32

Gene: VS_II0366: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14

Gene: VAS14_21822: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Photobacterium profundum SS9

Gene: PBPRA0168: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
VV20566
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6

Gene: VV20566: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06270: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0538: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Vibrio shilonii AK1

Gene: VSAK1_17002: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Vibrio splendidus LGP32

Gene: VS_II0367: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14

Gene: VAS14_21817: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Photobacterium profundum SS9

Gene: PBPRA0169: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
VV20565
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6

Gene: VV20565: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06269: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0539: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Vibrio shilonii AK1

Gene: VSAK1_16997: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Vibrio splendidus LGP32

Gene: VS_II0368: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14

Gene: VAS14_21812: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Photobacterium profundum SS9

Gene: PBPRA0170: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
CRON 76.
feoA
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
*
Photobacterium profundum SS9

Site:
position = -97
score = 5.23365
sequence = AAACTATAATAGTTATCATTT

Gene: PBPRB1905: Ferrous iron transport protein A
Ferrous iron transport protein A
feoB
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRB1904: Ferrous iron transport protein B
Ferrous iron transport protein B
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD