Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GlcC - Rhodobacterales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: activator (repressor)
Biological process: Glycolate utilization
Effector: Glycolate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 1 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Rhodobacter sphaeroides 2.4.1
Paracoccus denitrificans PD1222 3 1
Jannaschia sp. CCS1
Rhodobacterales bacterium HTCC2654
Oceanicola granulosus HTCC2516
Loktanella vestfoldensis SKA53
Oceanicola batsensis HTCC2597
Roseovarius nubinhibens ISM
Roseovarius sp. 217
Sulfitobacter sp. EE-36
Silicibacter TM1040
Silicibacter pomeroyi DSS-3
Roseobacter sp. MED193
Hyphomonas neptunium ATCC 15444
Oceanicaulis alexandrii HTCC2633
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
glcD
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_1020: Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD
*
Paracoccus denitrificans PD1222

Site:
position = -71
score = 6.09976
sequence = ATGTGGTCTGAAAATTATACCAAGA

Gene: Pden_4399: Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD
 
Jannaschia sp. CCS1

Gene: Jann_0690: Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_17716: Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD
 
Oceanicola granulosus HTCC2516

Gene: OG2516_16881: Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD
 
Loktanella vestfoldensis SKA53

Gene: SKA53_15141: Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD
 
Oceanicola batsensis HTCC2597

Gene: OB2597_12136: Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD
 
Roseovarius nubinhibens ISM

Gene: ISM_09030: Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD
 
Roseovarius sp. 217

Gene: ROS217_09005: Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD
 
Sulfitobacter sp. EE-36

Gene: EE36_08128: Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD
 
Silicibacter TM1040

Gene: TM1040_2502: Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD
 
Silicibacter pomeroyi DSS-3

Gene: SPO3478: Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD
 
Roseobacter sp. MED193

Gene: MED193_15702: Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD
glcE
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_1019: Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE
 
Paracoccus denitrificans PD1222

Gene: Pden_4398: Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE
 
Jannaschia sp. CCS1

Gene: Jann_0691: Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_17721: Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE
 
Oceanicola granulosus HTCC2516

Gene: OG2516_16876: Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE
 
Loktanella vestfoldensis SKA53

Gene: SKA53_15136: Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE
 
Oceanicola batsensis HTCC2597

Gene: OB2597_12141: Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE
 
Roseovarius nubinhibens ISM

Gene: ISM_09025: Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE
 
Roseovarius sp. 217

Gene: ROS217_09000: Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE
 
Sulfitobacter sp. EE-36

Gene: EE36_08133: Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE
 
Silicibacter TM1040

Gene: TM1040_2501: Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE
 
Silicibacter pomeroyi DSS-3

Gene: SPO3479: Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE
 
Roseobacter sp. MED193

Gene: MED193_15707: Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE
glcF
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_1018: Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
 
Paracoccus denitrificans PD1222

Gene: Pden_4397: Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
 
Jannaschia sp. CCS1

Gene: Jann_0693: Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_17726: Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
 
Oceanicola granulosus HTCC2516

Gene: OG2516_16871: Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
 
Loktanella vestfoldensis SKA53

Gene: SKA53_15131: Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
 
Oceanicola batsensis HTCC2597

Gene: OB2597_12151: Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
 
Roseovarius nubinhibens ISM

Gene: ISM_09020: Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
 
Roseovarius sp. 217

Gene: ROS217_08995: Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
 
Sulfitobacter sp. EE-36

Gene: EE36_08143: Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
 
Silicibacter TM1040

Gene: TM1040_2500: Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
 
Silicibacter pomeroyi DSS-3

Gene: SPO3480: Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
 
Roseobacter sp. MED193

Gene: MED193_15712: Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD