Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GlcC - Rhizobiales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: activator (repressor)
Biological process: Glycolate utilization
Effector: Glycolate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 21 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Sinorhizobium meliloti 1021 7 5
Rhizobium sp. NGR234 3 3
Rhizobium leguminosarum bv. viciae 3841
Rhizobium etli CFN 42
Agrobacterium tumefaciens str. C58 (Cereon) 5 3
Mesorhizobium sp. BNC1 9 3
Mesorhizobium loti MAFF303099 7 3
Brucella melitensis 16M 9 4
Bartonella quintana str. Toulouse
Rhodopseudomonas palustris CGA009
Bradyrhizobium japonicum USDA 110
Bradyrhizobium sp. BTAi1
Nitrobacter winogradskyi Nb-255
Azorhizobium caulinodans ORS 571
Xanthobacter autotrophicus Py2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
mlr6914
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
*
Mesorhizobium sp. BNC1

Site:
position = -119
score = 4.23926
sequence = AACTGGTCAACTTATTTGTCCAATG

Gene: Meso_0365: uncharacterized conserved membrane protein
*
Mesorhizobium loti MAFF303099

Site:
position = -156
score = 5.16946
sequence = AACTGGTCAAATTATTTATCCAATT

Gene: mlr6914: uncharacterized conserved membrane protein
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
uncharacterized conserved membrane protein
 
CRON 2.
mlr6914
*
Sinorhizobium meliloti 1021

Site:
position = -130
score = 5.73182
sequence = AAGTGGTCAAATTGATTGTCCACTC

Gene: SMc00830: uncharacterized conserved membrane protein
*
Rhizobium sp. NGR234

Site:
position = -134
score = 6.27747
sequence = AAGTGGTCAAATCGATTGTCCACTT

Gene: NGR_c03900: uncharacterized conserved membrane protein
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0663: uncharacterized conserved membrane protein
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
uncharacterized conserved membrane protein
 
CRON 3.
glcD
*
Sinorhizobium meliloti 1021

Site:
position = -46
score = 5.83012
sequence = TAGTGGTAAGCAAAAAATACCACTT

Gene: SMc00832: Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD
 
Rhizobium sp. NGR234

Gene: NGR_c03920: Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL0864: Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD
 
Rhizobium etli CFN 42

Gene: RHE_CH00808: Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -51
score = 5.60924
sequence = AAGTGGTAAAGAAAGAATACCAGTT

Gene: Atu0665: Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD
*
Mesorhizobium sp. BNC1

Site:
position = -36
score = 4.67904
sequence = AACTGGTAAATAGATTAGACCAGTG

Gene: Meso_0364: Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD
*
Mesorhizobium loti MAFF303099

Site:
position = -113
score = 4.36085
sequence = CACTGGTAAAAGATTTTGACCAGTG

Gene: mlr6916: Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD
*
Brucella melitensis 16M

Site:
position = -78
score = 7.91699
sequence = AAGTGGTAAAAACGATTTACCACTT

Gene: BMEII1064: Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA1130: Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD
 
Bradyrhizobium japonicum USDA 110

Gene: bll7543: Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD
 
Bradyrhizobium sp. BTAi1

Gene: BBta_1662: Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_2581: Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD
 
Azorhizobium caulinodans ORS 571

Gene: AZC_0083: Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD
 
Xanthobacter autotrophicus Py2

Gene: Xaut_1870: Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD
Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD
glcE
 
Sinorhizobium meliloti 1021

Gene: SMc00833: Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE
 
Rhizobium sp. NGR234

Gene: NGR_c03930: Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL0865: Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE
 
Rhizobium etli CFN 42

Gene: RHE_CH00809: Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0666: Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE
 
Mesorhizobium sp. BNC1

Gene: Meso_0363: Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE
 
Mesorhizobium loti MAFF303099

Gene: mlr6919: Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE
 2
Brucella melitensis 16M

Gene: BMEII1063: Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE

Gene: BMEII1062: Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA1131: Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE
 
Bradyrhizobium japonicum USDA 110

Gene: bll7541: Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE
 
Bradyrhizobium sp. BTAi1

Gene: BBta_1663: Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_2580: Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE
 
Azorhizobium caulinodans ORS 571

Gene: AZC_0082: Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE
 
Xanthobacter autotrophicus Py2

Gene: Xaut_1869: Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE
Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE
glcF
 
Sinorhizobium meliloti 1021

Gene: SMc00926: Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
 
Rhizobium sp. NGR234

Gene: NGR_c03950: Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL0866: Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
 
Rhizobium etli CFN 42

Gene: RHE_CH00810: Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0667: Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
 
Mesorhizobium sp. BNC1

Gene: Meso_0361: Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
 
Mesorhizobium loti MAFF303099

Gene: mlr6920: Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
 
Brucella melitensis 16M

Gene: BMEII1061: Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA1132: Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
 
Bradyrhizobium japonicum USDA 110

Gene: bll7540: Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
 
Bradyrhizobium sp. BTAi1

Gene: BBta_1664: Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_2579: Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
 
Azorhizobium caulinodans ORS 571

Gene: AZC_0080: Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
 
Xanthobacter autotrophicus Py2

Gene: Xaut_1868: Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
NGR_c03940
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234

Gene: NGR_c03940: hypothetical protein
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1

Gene: Meso_0362: hypothetical protein
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
hypothetical protein
mlr6918
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099

Gene: mlr6918: hypothetical protein
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
hypothetical protein
 
CRON 4.
glcC
*
Sinorhizobium meliloti 1021

Site:
position = -73
score = 4.85127
sequence = GAGTGGACAATCAATTTGACCACTT

Gene: SMc00829: Glycolate utilization operon transcriptional activator
*
Rhizobium sp. NGR234

Site:
position = -101
score = 5.07116
sequence = AAGTGGACAATCGATTTGACCACTT

Gene: NGR_c03890: Glycolate utilization operon transcriptional activator
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -90
score = 4.94858
sequence = AACTGGATAGAATAATTGACCAGTA

Gene: Atu0662: Glycolate utilization operon transcriptional activator
*
Mesorhizobium sp. BNC1

Site:
position = -58
score = 4.14096
sequence = CATTGGACAAATAAGTTGACCAGTT

Gene: Meso_0366: Glycolate utilization operon transcriptional activator
*
Mesorhizobium loti MAFF303099

Site:
position = -78
score = 4.63039
sequence = AATTGGATAAATAATTTGACCAGTT

Gene: mll6911: Glycolate utilization operon transcriptional activator
 
Brucella melitensis 16M

Gene: BMEII1066: Glycolate utilization operon transcriptional activator
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Glycolate utilization operon transcriptional activator
ykgE
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1

Gene: Meso_0367: L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2

Gene: Xaut_1769: L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE
L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE
ykgF
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1

Gene: Meso_0368: L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2

Gene: Xaut_1768: L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF
L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF
ykgG
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1

Gene: Meso_0369: L-lactate dehydrogenase, hypothetical protein subunit YkgG
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2

Gene: Xaut_1767: L-lactate dehydrogenase, hypothetical protein subunit YkgG
L-lactate dehydrogenase, hypothetical protein subunit YkgG
lysR
*
Sinorhizobium meliloti 1021

Site:
position = -178
score = 4.67904
sequence = AAGTGGTATTTTTTGCTTACCACTA

Gene: SMc00831: Transcriptional regulator, LysR family, in glycolate utilization operon
 
Rhizobium sp. NGR234

Gene: NGR_c03910: Transcriptional regulator, LysR family, in glycolate utilization operon
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL0863: Transcriptional regulator, LysR family, in glycolate utilization operon
 
Rhizobium etli CFN 42

Gene: RHE_CH00807: Transcriptional regulator, LysR family, in glycolate utilization operon
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -85
score = 4.85028
sequence = AACTGGTATTCTTTCTTTACCACTT

Gene: Atu0664: Transcriptional regulator, LysR family, in glycolate utilization operon
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
*
Brucella melitensis 16M

Site:
position = -111
score = 5.95171
sequence = AAGTGGTAAATCGTTTTTACCACTT

Gene: BMEII1065: Transcriptional regulator, LysR family, in glycolate utilization operon
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_0084: Transcriptional regulator, LysR family, in glycolate utilization operon
 
Xanthobacter autotrophicus Py2

Gene: Xaut_1871: Transcriptional regulator, LysR family, in glycolate utilization operon
Transcriptional regulator, LysR family, in glycolate utilization operon
lldD
*
Sinorhizobium meliloti 1021

Site:
position = -100
score = 4.14096
sequence = GAGAGGTAAGATTTTTTGACCTCTC

Gene: SMb20850: L-lactate dehydrogenase (EC 1.1.2.3)
*
Rhizobium sp. NGR234

Site:
position = -202
score = 4.58173
sequence = AAGAGGTCAATTTTTTTGACCTCTT

Gene: NGR_c23940: L-lactate dehydrogenase (EC 1.1.2.3)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL3578: L-lactate dehydrogenase (EC 1.1.2.3)
 
Rhizobium etli CFN 42

Gene: RHE_CH03131: L-lactate dehydrogenase (EC 1.1.2.3)
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2318: L-lactate dehydrogenase (EC 1.1.2.3)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099

Gene: mll6909: L-lactate dehydrogenase (EC 1.1.2.3)
*
Brucella melitensis 16M

Site:
position = -33
score = 4.58173
sequence = GATTGGTAAAGAAAACTGACCACAA

Gene: BMEII0377: L-lactate dehydrogenase (EC 1.1.2.3)
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA4320: L-lactate dehydrogenase (EC 1.1.2.3)
 
Bradyrhizobium japonicum USDA 110

Gene: blr7409: L-lactate dehydrogenase (EC 1.1.2.3)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_1816: L-lactate dehydrogenase (EC 1.1.2.3)
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_2267: L-lactate dehydrogenase (EC 1.1.2.3)
 
Xanthobacter autotrophicus Py2
L-lactate dehydrogenase (EC 1.1.2.3)
 
CRON 5.
lldP
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
*2
Brucella melitensis 16M

Gene: BMEI1233: L-lactate permease

Site:
position = -171
score = 4.45915
sequence = CTCTGGTAAAGTAAGTTTACCAATC

Gene: BMEI1232: L-lactate permease
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4350: L-lactate permease
L-lactate permease
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD