Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NrtR2 - Cyanobacteria

Properties
Regulator type: Transcription factor
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Phylum: Cyanobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Cyanothece sp. ATCC 51142
Cyanothece sp. PCC 7425 5 1
Cyanothece sp. PCC 8801
Gloeobacter violaceus PCC 7421
Microcystis aeruginosa NIES-843
Nostoc sp. PCC 7120
Prochlorococcus marinus str. MIT 9313
Synechococcus elongatus PCC 7942
Synechococcus sp. JA-3-3Ab
Synechococcus sp. PCC 7002 3 3
Synechococcus sp. WH 8102
Synechocystis sp. PCC 6803
Thermosynechococcus elongatus BP-1
Trichodesmium erythraeum IMS101
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
Cyan7425_2213
 
Cyanothece sp. ATCC 51142
*
Cyanothece sp. PCC 7425

Site:
position = -49
score = 5.13245
sequence = ATAGTGTTATTGAGACACTAT

Site:
position = -26
score = 5.92812
sequence = TTAGTGTAGTTTATACACAAA

Gene: Cyan7425_2213: hypothetical protein
 
Cyanothece sp. PCC 8801
 
Gloeobacter violaceus PCC 7421
 
Microcystis aeruginosa NIES-843
 
Nostoc sp. PCC 7120
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus elongatus PCC 7942
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. PCC 7002
 
Synechococcus sp. WH 8102
 
Synechocystis sp. PCC 6803
 
Thermosynechococcus elongatus BP-1
 
Trichodesmium erythraeum IMS101
hypothetical protein
draG
 
Cyanothece sp. ATCC 51142
 
Cyanothece sp. PCC 7425

Gene: Cyan7425_2212: ADP-ribosylglycohydrolase superfamkily
 
Cyanothece sp. PCC 8801
 
Gloeobacter violaceus PCC 7421
 
Microcystis aeruginosa NIES-843
 
Nostoc sp. PCC 7120

Gene: alr3188: ADP-ribosylglycohydrolase superfamkily
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus elongatus PCC 7942
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. PCC 7002
 
Synechococcus sp. WH 8102
 
Synechocystis sp. PCC 6803
 
Thermosynechococcus elongatus BP-1
 
Trichodesmium erythraeum IMS101
ADP-ribosylglycohydrolase superfamkily
Cyan7425_2211
 
Cyanothece sp. ATCC 51142
 
Cyanothece sp. PCC 7425

Gene: Cyan7425_2211: hypothetical protein
 
Cyanothece sp. PCC 8801
 
Gloeobacter violaceus PCC 7421
 
Microcystis aeruginosa NIES-843
 
Nostoc sp. PCC 7120
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus elongatus PCC 7942
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. PCC 7002
 
Synechococcus sp. WH 8102
 
Synechocystis sp. PCC 6803
 
Thermosynechococcus elongatus BP-1
 
Trichodesmium erythraeum IMS101
hypothetical protein
pncA
 
Cyanothece sp. ATCC 51142

Gene: cce_1052: Nicotinamidase (EC 3.5.1.19)
 
Cyanothece sp. PCC 7425

Gene: Cyan7425_2210: Nicotinamidase (EC 3.5.1.19)
 
Cyanothece sp. PCC 8801

Gene: PCC8801_3726: Nicotinamidase (EC 3.5.1.19)
 
Gloeobacter violaceus PCC 7421
 
Microcystis aeruginosa NIES-843
 
Nostoc sp. PCC 7120

Gene: alr5162: Nicotinamidase (EC 3.5.1.19)
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus elongatus PCC 7942
 
Synechococcus sp. JA-3-3Ab

Gene: CYA_1522: Nicotinamidase (EC 3.5.1.19)
*
Synechococcus sp. PCC 7002

Site:
position = -66
score = 4.18529
sequence = aatGTGTtttTaaaACACcAc

Gene: SYNPCC7002_A0642: Nicotinamidase (EC 3.5.1.19)
 
Synechococcus sp. WH 8102
 
Synechocystis sp. PCC 6803
 
Thermosynechococcus elongatus BP-1
 
Trichodesmium erythraeum IMS101

Gene: Tery_2452: Nicotinamidase (EC 3.5.1.19)
Nicotinamidase (EC 3.5.1.19)
Cyan7425_2209
 
Cyanothece sp. ATCC 51142
 
Cyanothece sp. PCC 7425

Gene: Cyan7425_2209: hypothetical protein
 
Cyanothece sp. PCC 8801
 
Gloeobacter violaceus PCC 7421
 
Microcystis aeruginosa NIES-843
 
Nostoc sp. PCC 7120
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus elongatus PCC 7942
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. PCC 7002
 
Synechococcus sp. WH 8102
 
Synechocystis sp. PCC 6803
 
Thermosynechococcus elongatus BP-1
 
Trichodesmium erythraeum IMS101
hypothetical protein
 
CRON 2.
nadE
 
Cyanothece sp. ATCC 51142
 
Cyanothece sp. PCC 7425
 
Cyanothece sp. PCC 8801
 
Gloeobacter violaceus PCC 7421
 
Microcystis aeruginosa NIES-843
 
Nostoc sp. PCC 7120
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus elongatus PCC 7942

Gene: Synpcc7942_0105: NAD synthetase (EC 6.3.1.5)
 
Synechococcus sp. JA-3-3Ab
*
Synechococcus sp. PCC 7002

Site:
position = -123
score = 5.67676
sequence = TTGATGTAGAATCGACACTAA

Gene: SYNPCC7002_A1784: NAD synthetase (EC 6.3.1.5)
 
Synechococcus sp. WH 8102
 
Synechocystis sp. PCC 6803
 
Thermosynechococcus elongatus BP-1
 
Trichodesmium erythraeum IMS101
NAD synthetase (EC 6.3.1.5)
 
CRON 3.
pncB
 
Cyanothece sp. ATCC 51142

Gene: cce_2759: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Cyanothece sp. PCC 7425

Gene: Cyan7425_2236: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Cyanothece sp. PCC 8801

Gene: PCC8801_0271: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Gloeobacter violaceus PCC 7421
 
Microcystis aeruginosa NIES-843
 
Nostoc sp. PCC 7120

Gene: alr2482: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus elongatus PCC 7942
 
Synechococcus sp. JA-3-3Ab

Gene: CYA_1521: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
*
Synechococcus sp. PCC 7002

Site:
position = -50
score = 5.54082
sequence = TTATTGTAAAATAAACACTAA

Gene: SYNPCC7002_A0508: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Synechococcus sp. WH 8102
 
Synechocystis sp. PCC 6803
 
Thermosynechococcus elongatus BP-1

Gene: tlr1177: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Trichodesmium erythraeum IMS101

Gene: Tery_0318: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD