Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NagC - Oceanospirillales/Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: N-acetylglucosamine utilization
Effector: N-acetylglucosamine-6-phosphate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Hahella chejuensis KCTC 2396
Marinobacter aqueolei
Marinobacter sp. ELB17
Oceanobacter sp. RED65
Oceanospirillum sp. MED92
Marinomonas sp. MWYL1
Saccharophagus degradans 2-40
Teredinibacter turnerae T7901
Cellvibrio japonicus Ueda107
Chromohalobacter salexigens DSM 3043
Reinekea sp. MED297 7 5
Alcanivorax borkumensis SK2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
mcp2
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92

Gene: MED92_03503: Hypothetical methyl-accepting chemotaxis protein
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_3346: Hypothetical methyl-accepting chemotaxis protein
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
*
Reinekea sp. MED297

Site:
position = -149
score = 5.38124
sequence = ATTATTTTTGACTTAAATCAATT

Gene: MED297_10246: Hypothetical methyl-accepting chemotaxis protein
 
Alcanivorax borkumensis SK2
Hypothetical methyl-accepting chemotaxis protein
 
CRON 2.
mcp
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
*
Reinekea sp. MED297

Site:
position = -50
score = 5.5899
sequence = ATTTGATTCATAAAAAATAAAAT

Gene: MED297_09986: Methyl-accepting chemotaxis protein
 
Alcanivorax borkumensis SK2
Methyl-accepting chemotaxis protein
 
CRON 3.
nagC
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
*
Reinekea sp. MED297

Site:
position = -121
score = 5.77933
sequence = ATAATTTTCAGAATGAATTAAAT

Gene: MED297_06339: N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
 
Alcanivorax borkumensis SK2
N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
 
CRON 4.
nagE
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
*2
Reinekea sp. MED297

Site:
position = -154
score = 5.77933
sequence = ATTTAATTCATTCTGAAAATTAT

Gene: MED297_06344: PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, glucose-specific IIC component (EC 2.7.1.69)

Gene: MED297_19592: PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, glucose-specific IIC component (EC 2.7.1.69)
 
Alcanivorax borkumensis SK2
PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, glucose-specific IIC component (EC 2.7.1.69)
nagF
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
*2
Reinekea sp. MED297

Gene: MED297_06349: PTS system, glucose-specific IIA component (EC 2.7.1.69) / Phosphocarrier protein of PTS system / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)

Site:
position = -100
score = 6.02063
sequence = ATCTGATTTAAGTCAAAAAAAAT

Gene: MED297_19597: PTS system, glucose-specific IIA component (EC 2.7.1.69) / Phosphocarrier protein of PTS system / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Alcanivorax borkumensis SK2
PTS system, glucose-specific IIA component (EC 2.7.1.69) / Phosphocarrier protein of PTS system / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD