Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NagC - Psychromonadaceae/Aeromonadales

Properties
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: N-acetylglucosamine utilization
Effector: N-acetylglucosamine-6-phosphate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Psychromonas ingrahamii 37 1 1
Psychromonas sp. CNPT3 3 2
Moritella sp. PE36 8 4
Aeromonas hydrophila subsp. hydrophila ATCC 7966 8 3
Aeromonas salmonicida subsp. salmonicida A449 8 3
Tolumonas auensis DSM 9187 4 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
ptsH
 
Psychromonas ingrahamii 37

Gene: Ping_2439: Phosphocarrier protein of PTS system
 
Psychromonas sp. CNPT3

Gene: PCNPT3_08555: Phosphocarrier protein of PTS system
*
Moritella sp. PE36

Site:
position = -87
score = 5.95042
sequence = TTATTTTACTCTGTAAAATTA

Gene: PE36_18600: Phosphocarrier protein of PTS system
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -228
score = 6.11858
sequence = TTATTTTTCGTTATAAAATAA

Gene: AHA_3039: Phosphocarrier protein of PTS system
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -228
score = 6.11858
sequence = TTATTTTTCGTTATAAAATAA

Gene: ASA_3060: Phosphocarrier protein of PTS system
 
Tolumonas auensis DSM 9187

Gene: Tola_0626: Phosphocarrier protein of PTS system
Phosphocarrier protein of PTS system
ptsI
 
Psychromonas ingrahamii 37

Gene: Ping_2440: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Psychromonas sp. CNPT3

Gene: PCNPT3_08565: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Moritella sp. PE36

Gene: PE36_18605: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_3040: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_3061: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Tolumonas auensis DSM 9187

Gene: Tola_0625: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
crr
 
Psychromonas ingrahamii 37

Gene: Ping_2441: PTS system, glucose-specific IIA component (EC 2.7.1.69)
 
Psychromonas sp. CNPT3

Gene: PCNPT3_08575: PTS system, glucose-specific IIA component (EC 2.7.1.69)
 
Moritella sp. PE36

Gene: PE36_18610: PTS system, glucose-specific IIA component (EC 2.7.1.69)
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_3041: PTS system, glucose-specific IIA component (EC 2.7.1.69)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_3062: PTS system, glucose-specific IIA component (EC 2.7.1.69)
 
Tolumonas auensis DSM 9187

Gene: Tola_0624: PTS system, glucose-specific IIA component (EC 2.7.1.69)
PTS system, glucose-specific IIA component (EC 2.7.1.69)
 
CRON 2.
nagB
 
Psychromonas ingrahamii 37

Gene: Ping_0490: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Psychromonas sp. CNPT3

Site:
position = -52
score = 5.09286
sequence = TTAATTTACGCTGTGTATTAA

Gene: PCNPT3_12872: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Moritella sp. PE36

Site:
position = -58
score = 5.98171
sequence = TTAATTTACAATTAAAAAAAA

Gene: PE36_19400: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -86
score = 5.77583
sequence = TTTATTTACGCTATAAAACAA

Gene: AHA_1526: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -86
score = 5.77583
sequence = TTTATTTACGCTATAAAACAA

Gene: ASA_2828: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Tolumonas auensis DSM 9187

Site:
position = -50
score = 5.55065
sequence = TTTATTCACAATTAAAAATAA

Gene: Tola_2136: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
nagA
*
Psychromonas ingrahamii 37

Site:
position = -161
score = 5.27689
sequence = CAATTTTCAATTGTAAAATAA

Gene: Ping_0489: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Psychromonas sp. CNPT3

Gene: PCNPT3_12877: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Moritella sp. PE36

Gene: PE36_19405: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1525: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_2829: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Tolumonas auensis DSM 9187

Gene: Tola_2137: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
nagC
 
Psychromonas ingrahamii 37

Gene: Ping_0488: N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
 
Psychromonas sp. CNPT3

Gene: PCNPT3_12882: N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
 
Moritella sp. PE36

Gene: PE36_19410: N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1524: N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_2830: N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
 
Tolumonas auensis DSM 9187

Gene: Tola_2138: N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
 
CRON 3.
chi
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -172
score = 6.29526
sequence = TTATTTTACTCTGTAAAATAA

Gene: PE36_05108: Chitodextrinase precursor
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Chitodextrinase precursor
 
CRON 4.
nagE
 
Psychromonas ingrahamii 37

Gene: Ping_0491: PTS system, N-acetylglucosamine-specific IIA component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)
*
Psychromonas sp. CNPT3

Site:
position = -257
score = 5.09286
sequence = TTAATACACAGCGTAAATTAA

Gene: PCNPT3_12867: PTS system, N-acetylglucosamine-specific IIA component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)
*
Moritella sp. PE36

Site:
position = -179
score = 5.98171
sequence = TTTTTTTTAATTGTAAATTAA

Site:
position = -53
score = 4.96808
sequence = TTACTTTACATTACGAAATAA

Gene: PE36_19395: PTS system, N-acetylglucosamine-specific IIA component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -208
score = 5.77583
sequence = TTGTTTTATAGCGTAAATAAA

Gene: AHA_1527: PTS system, N-acetylglucosamine-specific IIA component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -208
score = 5.77583
sequence = TTGTTTTATAGCGTAAATAAA

Gene: ASA_2827: PTS system, N-acetylglucosamine-specific IIA component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)
*
Tolumonas auensis DSM 9187

Site:
position = -158
score = 5.55065
sequence = TTATTTTTAATTGTGAATAAA

Gene: Tola_2135: PTS system, N-acetylglucosamine-specific IIA component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)
PTS system, N-acetylglucosamine-specific IIA component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)
hex
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_11452: Beta-hexosaminidase (EC 3.2.1.52)
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1528: Beta-hexosaminidase (EC 3.2.1.52)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_2826: Beta-hexosaminidase (EC 3.2.1.52)
 
Tolumonas auensis DSM 9187
Beta-hexosaminidase (EC 3.2.1.52)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD