Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NagC - Pasteurellales

Properties
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: N-acetylglucosamine utilization
Effector: N-acetylglucosamine-6-phosphate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Haemophilus influenzae Rd KW20
Aggregatibacter aphrophilus NJ8700 8 5
Pasteurella multocida subsp. multocida str. Pm70 14 9
Mannheimia succiniciproducens MBEL55E
Actinobacillus succinogenes 130Z
Haemophilus somnus 2336
Actinobacillus pleuropneumoniae serovar 7 str. AP76
Haemophilus ducreyi 35000HP
Haemophilus parasuis SH0165
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
omp
 
Haemophilus influenzae Rd KW20

Gene: HI1217: Outer membrane receptor protein
*
Aggregatibacter aphrophilus NJ8700

Site:
position = -214
score = 6.53227
sequence = TTATTTTTTATCATAAAATAA

Gene: NT05HA_2308: Outer membrane receptor protein
*4
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM0745: Outer membrane receptor protein

Gene: PM1081: Outer membrane receptor protein

Site:
position = -89
score = 6.75783
sequence = TTATTTTTTATTGAAAAATAA

Gene: PM1428: Outer membrane receptor protein

Site:
position = -35
score = 6.57669
sequence = TTTTTTTTCATTGAAAAATAA

Gene: PM1282: Outer membrane receptor protein
 
Mannheimia succiniciproducens MBEL55E
 
Actinobacillus succinogenes 130Z
 2
Haemophilus somnus 2336

Gene: HSM_0047: Outer membrane receptor protein

Gene: HSM_1962: Outer membrane receptor protein
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_0978: Outer membrane receptor protein
 
Haemophilus ducreyi 35000HP
 2
Haemophilus parasuis SH0165

Gene: HAPS_1568: Outer membrane receptor protein

Gene: HAPS_0355: Outer membrane receptor protein
Outer membrane receptor protein
 
CRON 2.
ptsH
 
Haemophilus influenzae Rd KW20

Gene: HI1713: Phosphocarrier protein of PTS system
*
Aggregatibacter aphrophilus NJ8700

Site:
position = -84
score = 5.58831
sequence = TTATTTTAGTGTTTTAAATAA

Gene: NT05HA_0617: Phosphocarrier protein of PTS system
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -104
score = 6.36271
sequence = TTATTTTTTATCCAAAAATAA

Gene: PM0898: Phosphocarrier protein of PTS system
 
Mannheimia succiniciproducens MBEL55E

Gene: MS1510: Phosphocarrier protein of PTS system
 
Actinobacillus succinogenes 130Z

Gene: Asuc_0994: Phosphocarrier protein of PTS system
 
Haemophilus somnus 2336

Gene: HSM_1009: Phosphocarrier protein of PTS system
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_1373: Phosphocarrier protein of PTS system
 
Haemophilus ducreyi 35000HP

Gene: HD0229: Phosphocarrier protein of PTS system
 
Haemophilus parasuis SH0165

Gene: HAPS_0960: Phosphocarrier protein of PTS system
Phosphocarrier protein of PTS system
ptsI
 
Haemophilus influenzae Rd KW20

Gene: HI1712: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_0618: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM0897: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Mannheimia succiniciproducens MBEL55E

Gene: MS1509: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Actinobacillus succinogenes 130Z

Gene: Asuc_0995: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Haemophilus somnus 2336

Gene: HSM_1010: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_1374: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Haemophilus ducreyi 35000HP

Gene: HD0228: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Haemophilus parasuis SH0165

Gene: HAPS_0959: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
crr
 
Haemophilus influenzae Rd KW20

Gene: HI1711: PTS system, glucose-specific IIA component (EC 2.7.1.69)
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_0619: PTS system, glucose-specific IIA component (EC 2.7.1.69)
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM0896: PTS system, glucose-specific IIA component (EC 2.7.1.69)
 
Mannheimia succiniciproducens MBEL55E

Gene: MS1508: PTS system, glucose-specific IIA component (EC 2.7.1.69)
 
Actinobacillus succinogenes 130Z

Gene: Asuc_0996: PTS system, glucose-specific IIA component (EC 2.7.1.69)
 
Haemophilus somnus 2336

Gene: HSM_1011: PTS system, glucose-specific IIA component (EC 2.7.1.69)
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_1375: PTS system, glucose-specific IIA component (EC 2.7.1.69)
 
Haemophilus ducreyi 35000HP

Gene: HD0227: PTS system, glucose-specific IIA component (EC 2.7.1.69)
 
Haemophilus parasuis SH0165

Gene: HAPS_0958: PTS system, glucose-specific IIA component (EC 2.7.1.69)
PTS system, glucose-specific IIA component (EC 2.7.1.69)
 
CRON 3.
exbB
 
Haemophilus influenzae Rd KW20

Gene: HI0253: Biopolymer transport protein ExbB
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_1575: Biopolymer transport protein ExbB
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -33
score = 5.57644
sequence = TTATTTTGCGATACAAATTAA

Gene: PM1186: Biopolymer transport protein ExbB
 
Mannheimia succiniciproducens MBEL55E

Gene: MS0515: Biopolymer transport protein ExbB
 
Actinobacillus succinogenes 130Z

Gene: Asuc_2012: Biopolymer transport protein ExbB
 
Haemophilus somnus 2336

Gene: HSM_1102: Biopolymer transport protein ExbB
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_0078: Biopolymer transport protein ExbB
 
Haemophilus ducreyi 35000HP

Gene: HD0329: Biopolymer transport protein ExbB
 
Haemophilus parasuis SH0165

Gene: HAPS_1366: Biopolymer transport protein ExbB
Biopolymer transport protein ExbB
exbD
 
Haemophilus influenzae Rd KW20

Gene: HI0252: Biopolymer transport protein ExbD/TolR
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_1574: Biopolymer transport protein ExbD/TolR
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM1187: Biopolymer transport protein ExbD/TolR
 
Mannheimia succiniciproducens MBEL55E

Gene: MS0514: Biopolymer transport protein ExbD/TolR
 
Actinobacillus succinogenes 130Z

Gene: Asuc_2011: Biopolymer transport protein ExbD/TolR
 
Haemophilus somnus 2336

Gene: HSM_1101: Biopolymer transport protein ExbD/TolR
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_0077: Biopolymer transport protein ExbD/TolR
 
Haemophilus ducreyi 35000HP

Gene: HD0328: Biopolymer transport protein ExbD/TolR
 
Haemophilus parasuis SH0165

Gene: HAPS_1365: Biopolymer transport protein ExbD/TolR
Biopolymer transport protein ExbD/TolR
tonB
 
Haemophilus influenzae Rd KW20

Gene: HI0251: Periplasmic binding protein TonB
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_1573: Periplasmic binding protein TonB
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM1188: Periplasmic binding protein TonB
 
Mannheimia succiniciproducens MBEL55E

Gene: MS0513: Periplasmic binding protein TonB
 
Actinobacillus succinogenes 130Z

Gene: Asuc_2010: Periplasmic binding protein TonB
 
Haemophilus somnus 2336

Gene: HSM_1100: Periplasmic binding protein TonB
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_0076: Periplasmic binding protein TonB
 
Haemophilus ducreyi 35000HP

Gene: HD0327: Periplasmic binding protein TonB
 
Haemophilus parasuis SH0165

Gene: HAPS_1364: Periplasmic binding protein TonB
Periplasmic binding protein TonB
 
CRON 4.
nagB
 
Haemophilus influenzae Rd KW20

Gene: HI0141: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_0549: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -132
score = 6.43693
sequence = TTATTTTATAATGCAAAAAAA

Gene: PM0875: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
 
Mannheimia succiniciproducens MBEL55E

Gene: MS2205: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
 
Actinobacillus succinogenes 130Z
 
Haemophilus somnus 2336

Gene: HSM_1505: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_1840: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
 
Haemophilus ducreyi 35000HP

Gene: HD1847: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
 
Haemophilus parasuis SH0165

Gene: HAPS_2072: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
nagA
 
Haemophilus influenzae Rd KW20

Gene: HI0140: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_0550: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM0874: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Mannheimia succiniciproducens MBEL55E

Gene: MS2204: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Actinobacillus succinogenes 130Z

Gene: Asuc_1103: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Haemophilus somnus 2336

Gene: HSM_1504: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_1841: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Haemophilus ducreyi 35000HP

Gene: HD1845: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Haemophilus parasuis SH0165

Gene: HAPS_2071: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
CRON 5.
rpmE1
 
Haemophilus influenzae Rd KW20
*
Aggregatibacter aphrophilus NJ8700

Site:
position = -96
score = 5.80047
sequence = TTATTTTTCTATTGAAAATAA

Site:
position = -33
score = 6.61808
sequence = TTATTTTTCACTAAAAAATAA

Gene: NT05HA_1390: 50S ribosomal protein L31
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -98
score = 5.78562
sequence = TTATTTTCCCATAAAAAATAA

Site:
position = -34
score = 6.36271
sequence = TTATTTTTCAGAAAAAAATAA

Gene: PM0220: 50S ribosomal protein L31
 
Mannheimia succiniciproducens MBEL55E
 
Actinobacillus succinogenes 130Z
 
Haemophilus somnus 2336
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_1907: 50S ribosomal protein L31
 
Haemophilus ducreyi 35000HP

Gene: HD1927: 50S ribosomal protein L31
 
Haemophilus parasuis SH0165

Gene: HAPS_1799: 50S ribosomal protein L31
50S ribosomal protein L31
rpmJ1
 
Haemophilus influenzae Rd KW20
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_1389: ribosomal protein L36
 
Pasteurella multocida subsp. multocida str. Pm70
 
Mannheimia succiniciproducens MBEL55E
 
Actinobacillus succinogenes 130Z
 
Haemophilus somnus 2336
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_1908: ribosomal protein L36
 
Haemophilus ducreyi 35000HP

Gene: HD1926: ribosomal protein L36
 
Haemophilus parasuis SH0165

Gene: HAPS_1798: ribosomal protein L36
ribosomal protein L36
 
CRON 6.
nagE
 
Haemophilus influenzae Rd KW20
*
Aggregatibacter aphrophilus NJ8700

Site:
position = -36
score = 5.60996
sequence = TTATTTTATGGAATCAAAAAA

Gene: NT05HA_0540: PTS system, N-acetylglucosamine-specific IIA component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -196
score = 6.43693
sequence = TTTTTTTGCATTATAAAATAA

Gene: PM0876: PTS system, N-acetylglucosamine-specific IIA component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)
 
Mannheimia succiniciproducens MBEL55E
 
Actinobacillus succinogenes 130Z
 
Haemophilus somnus 2336
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165
PTS system, N-acetylglucosamine-specific IIA component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)
 
CRON 7.
znuA
 
Haemophilus influenzae Rd KW20

Gene: HI0119: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Aggregatibacter aphrophilus NJ8700

Site:
position = -103
score = 6.35113
sequence = TTATTTTTCAAAATAAAAAAA

Gene: NT05HA_1414: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -96
score = 6.23775
sequence = TTATTTTTTAGTTAAAAAAAA

Gene: PM0926: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Mannheimia succiniciproducens MBEL55E

Gene: MS1457: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Actinobacillus succinogenes 130Z

Gene: Asuc_1782: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Haemophilus somnus 2336

Gene: HSM_0813: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_1492: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Haemophilus ducreyi 35000HP

Gene: HD0198: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Haemophilus parasuis SH0165

Gene: HAPS_0913: Zinc ABC transporter, periplasmic-binding protein ZnuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
 
CRON 8.
gdhA
 
Haemophilus influenzae Rd KW20

Gene: HI0189: NADP-specific glutamate dehydrogenase (EC 1.4.1.4)
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_0070: NADP-specific glutamate dehydrogenase (EC 1.4.1.4)
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -134
score = 5.56514
sequence = TTTTTTTAAATAGACAAAAAA

Gene: PM0043: NADP-specific glutamate dehydrogenase (EC 1.4.1.4)
 
Mannheimia succiniciproducens MBEL55E

Gene: MS0196: NADP-specific glutamate dehydrogenase (EC 1.4.1.4)
 
Actinobacillus succinogenes 130Z

Gene: Asuc_0375: NADP-specific glutamate dehydrogenase (EC 1.4.1.4)
 
Haemophilus somnus 2336

Gene: HSM_0283: NADP-specific glutamate dehydrogenase (EC 1.4.1.4)
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_0451: NADP-specific glutamate dehydrogenase (EC 1.4.1.4)
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165
NADP-specific glutamate dehydrogenase (EC 1.4.1.4)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD