Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NagC - Vibrionales

Properties
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor (activator)
Biological process: N-acetylglucosamine utilization
Effector: N-acetylglucosamine-6-phosphate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 199 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Vibrio cholerae O1 biovar eltor str. N16961 27 20
Vibrio vulnificus CMCP6 30 21
Vibrio harveyi ATCC BAA-1116 24 17
Vibrio parahaemolyticus RIMD 2210633 27 19
Vibrio shilonii AK1 18 14
Vibrio splendidus LGP32 23 18
Vibrio fischeri ES114 25 20
Vibrio salmonicida LFI1238 20 14
Vibrio angustum S14 17 11
Photobacterium profundum SS9 25 17
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
adh
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -266
score = 5.16425
sequence = CTTTTTTTGTTTAATAAAAAATG

Gene: VIBHAR_03018: Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
*
Vibrio splendidus LGP32

Site:
position = -131
score = 5.09219
sequence = TTTTTTTCACACTGTGAAATAAT

Gene: VS_0958: Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)
 
CRON 2.
pyrG
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -131
score = 5.09569
sequence = TTTGATTTGAAGCAAAAAATAAA

Gene: VC2448: CTP synthase (EC 6.3.4.2)
*
Vibrio vulnificus CMCP6

Site:
position = -132
score = 5.09569
sequence = TTTGATTTGAAGCAAAAAATAAA

Gene: VV1_1578: CTP synthase (EC 6.3.4.2)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -132
score = 5.09569
sequence = TTTGATTTGAAGCAAAAAATAAA

Gene: VIBHAR_03526: CTP synthase (EC 6.3.4.2)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -132
score = 5.09569
sequence = TTTGATTTGAAGCAAAAAATAAA

Gene: VP2562: CTP synthase (EC 6.3.4.2)
*
Vibrio shilonii AK1

Site:
position = -133
score = 4.95855
sequence = ATTGATTTGAAGCAAAAAATAAA

Gene: VSAK1_08019: CTP synthase (EC 6.3.4.2)
*
Vibrio splendidus LGP32

Site:
position = -132
score = 4.95855
sequence = ATTGATTTGAAGCAAAAAATAAA

Gene: VS_2609: CTP synthase (EC 6.3.4.2)
*
Vibrio fischeri ES114

Site:
position = -136
score = 4.62952
sequence = ATTGATTTGGAGCAAAAAATAAA

Gene: VF_2076: CTP synthase (EC 6.3.4.2)
*
Vibrio salmonicida LFI1238

Site:
position = -135
score = 4.62952
sequence = ATTGATTTGGAGCAAAAAATAAA

Gene: VSAL_I2515: CTP synthase (EC 6.3.4.2)
*
Vibrio angustum S14

Site:
position = -128
score = 4.72127
sequence = CTTGATTTGAAGCAAAAAAAATC

Gene: VAS14_20436: CTP synthase (EC 6.3.4.2)
*
Photobacterium profundum SS9

Site:
position = -129
score = 4.76169
sequence = ATTGATTTGAGACAAAAAAAAAC

Gene: PBPRA3080: CTP synthase (EC 6.3.4.2)
CTP synthase (EC 6.3.4.2)
eno
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC2447: Enolase (EC 4.2.1.11)
 
Vibrio vulnificus CMCP6

Gene: VV1_1579: Enolase (EC 4.2.1.11)
 2
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06630: Enolase (EC 4.2.1.11)

Gene: VIBHAR_03525: Enolase (EC 4.2.1.11)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP2561: Enolase (EC 4.2.1.11)
 
Vibrio shilonii AK1

Gene: VSAK1_09903: Enolase (EC 4.2.1.11)
 
Vibrio splendidus LGP32

Gene: VS_2607: Enolase (EC 4.2.1.11)
 
Vibrio fischeri ES114

Gene: VF_2075: Enolase (EC 4.2.1.11)
 
Vibrio salmonicida LFI1238

Gene: VSAL_I2514: Enolase (EC 4.2.1.11)
 
Vibrio angustum S14

Gene: VAS14_20441: Enolase (EC 4.2.1.11)
 
Photobacterium profundum SS9

Gene: PBPRA3079: Enolase (EC 4.2.1.11)
Enolase (EC 4.2.1.11)
 
CRON 3.
ptsG
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -248
score = 5.07442
sequence = GTAATTTTGTTACTAAAAATAAC

Site:
position = -214
score = 4.56655
sequence = TTTTATTTACCCAGTAAAATTAA

Gene: VC2013: PTS system, glucose-specific IIB component (EC 2.7.1.69) / PTS system, glucose-specific IIC component (EC 2.7.1.69)
*
Vibrio vulnificus CMCP6

Site:
position = -320
score = 5.07442
sequence = GTAATTTTGTTACTAAAAATAAC

Gene: VV1_2999: PTS system, glucose-specific IIB component (EC 2.7.1.69) / PTS system, glucose-specific IIC component (EC 2.7.1.69)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -321
score = 5.07442
sequence = GTAATTTTGTTACTAAAAATAAC

Site:
position = -287
score = 4.9783
sequence = TTTTATTTACGCCTTAAAATTAA

Gene: VIBHAR_02900: PTS system, glucose-specific IIB component (EC 2.7.1.69) / PTS system, glucose-specific IIC component (EC 2.7.1.69)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -321
score = 5.07442
sequence = GTAATTTTGTTACTAAAAATAAC

Site:
position = -287
score = 4.9783
sequence = TTTTATTTACGCCTTAAAATTAA

Gene: VP2046: PTS system, glucose-specific IIB component (EC 2.7.1.69) / PTS system, glucose-specific IIC component (EC 2.7.1.69)
*
Vibrio shilonii AK1

Site:
position = -286
score = 4.74948
sequence = TTTTATTCACTGCGTAAAATTAA

Gene: VSAK1_26880: PTS system, glucose-specific IIB component (EC 2.7.1.69) / PTS system, glucose-specific IIC component (EC 2.7.1.69)
*
Vibrio splendidus LGP32

Site:
position = -321
score = 5.07442
sequence = GTAATTTTGTTACTAAAAATAAC

Site:
position = -287
score = 5.02615
sequence = TTTTATTTACTCAGTAAAATAAT

Gene: VS_1032: PTS system, glucose-specific IIB component (EC 2.7.1.69) / PTS system, glucose-specific IIC component (EC 2.7.1.69)
*
Vibrio fischeri ES114

Site:
position = -318
score = 4.98216
sequence = CTATTTTTGTTGCTAAAAATAAC

Gene: VF_1732: PTS system, glucose-specific IIB component (EC 2.7.1.69) / PTS system, glucose-specific IIC component (EC 2.7.1.69)
 
Vibrio salmonicida LFI1238

Gene: VSAL_I2252: PTS system, glucose-specific IIB component (EC 2.7.1.69) / PTS system, glucose-specific IIC component (EC 2.7.1.69)
 
Vibrio angustum S14
*2
Photobacterium profundum SS9

Site:
position = -335
score = 4.31812
sequence = GTATCTTCGTTACGTAAAATAAC

Gene: PBPRA1203: PTS system, glucose-specific IIB component (EC 2.7.1.69) / PTS system, glucose-specific IIC component (EC 2.7.1.69)

Gene: PBPRA1760: PTS system, glucose-specific IIB component (EC 2.7.1.69) / PTS system, glucose-specific IIC component (EC 2.7.1.69)
PTS system, glucose-specific IIB component (EC 2.7.1.69) / PTS system, glucose-specific IIC component (EC 2.7.1.69)
 
CRON 4.
chi1
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6

Gene: VV1_2342: Chitinase (EC 3.2.1.14)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -107
score = 5.46238
sequence = GTTATTTTTATTTATAAATTAAG

Gene: VIBHAR_05607: Chitinase (EC 3.2.1.14)
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Chitinase (EC 3.2.1.14)
 
CRON 5.
gltA
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC2092: Citrate synthase (si) (EC 2.3.3.1)
 
Vibrio vulnificus CMCP6

Gene: VV1_0162: Citrate synthase (si) (EC 2.3.3.1)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_01350: Citrate synthase (si) (EC 2.3.3.1)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP0842: Citrate synthase (si) (EC 2.3.3.1)
 
Vibrio shilonii AK1

Gene: VSAK1_08923: Citrate synthase (si) (EC 2.3.3.1)
 
Vibrio splendidus LGP32

Gene: VS_2249: Citrate synthase (si) (EC 2.3.3.1)
*
Vibrio fischeri ES114

Site:
position = -132
score = 5.24284
sequence = CTTTTTTTTCATTAAAAATATAA

Gene: VF_0818: Citrate synthase (si) (EC 2.3.3.1)
*
Vibrio salmonicida LFI1238

Site:
position = -132
score = 5.17577
sequence = CTTTTTTTTCATCAAAAATATAA

Gene: VSAL_I0841: Citrate synthase (si) (EC 2.3.3.1)
 
Vibrio angustum S14

Gene: VAS14_17726: Citrate synthase (si) (EC 2.3.3.1)
 
Photobacterium profundum SS9

Gene: PBPRA1043: Citrate synthase (si) (EC 2.3.3.1)
Citrate synthase (si) (EC 2.3.3.1)
 
CRON 6.
grcA
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -215
score = 5.33999
sequence = TATTTTTTATTATTTAAAATAAA

Gene: VC2361: autonomous glycyl radical cofactor GrcA
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -216
score = 5.11009
sequence = TATTTTTTATATTATCAAATAAA

Gene: VP0497: autonomous glycyl radical cofactor GrcA
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
*
Photobacterium profundum SS9

Site:
position = -204
score = 4.72438
sequence = TATTTTTTAAACTTTAAACTAAC

Gene: PBPRA0556: autonomous glycyl radical cofactor GrcA
autonomous glycyl radical cofactor GrcA
 
CRON 7.
mcp2
 
Vibrio cholerae O1 biovar eltor str. N16961
*
Vibrio vulnificus CMCP6

Site:
position = -120
score = 4.75664
sequence = TTTATTTTTAGCTTCGAATTTAT

Gene: VV20402: N-acetylglucosamine regulated methyl-accepting chemotaxis protein
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_04784: N-acetylglucosamine regulated methyl-accepting chemotaxis protein
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -185
score = 5.23844
sequence = TTTATTTTGAGCAGTAAAATATA

Gene: VPA1651: N-acetylglucosamine regulated methyl-accepting chemotaxis protein
 
Vibrio shilonii AK1
*
Vibrio splendidus LGP32

Site:
position = -29
score = 5.62171
sequence = TTTATTTTAAAGCGTAAAATAAA

Gene: VS_1728: N-acetylglucosamine regulated methyl-accepting chemotaxis protein
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238

Gene: VSAL_II1022: N-acetylglucosamine regulated methyl-accepting chemotaxis protein
 
Vibrio angustum S14
*
Photobacterium profundum SS9

Site:
position = -134
score = 4.57421
sequence = TTTTATTTCACTCAAAAATTAAC

Gene: PBPRB0407: N-acetylglucosamine regulated methyl-accepting chemotaxis protein
N-acetylglucosamine regulated methyl-accepting chemotaxis protein
 
CRON 8.
epd
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC0476: D-erythrose-4-phosphate dehydrogenase (EC 1.2.1.72)
 
Vibrio vulnificus CMCP6

Gene: VV1_1539: D-erythrose-4-phosphate dehydrogenase (EC 1.2.1.72)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_03566: D-erythrose-4-phosphate dehydrogenase (EC 1.2.1.72)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP2601: D-erythrose-4-phosphate dehydrogenase (EC 1.2.1.72)
 
Vibrio shilonii AK1
*
Vibrio splendidus LGP32

Site:
position = -103
score = 4.41626
sequence = GTTTATTTGTATCTAAAGTTATG

Gene: VS_2648: D-erythrose-4-phosphate dehydrogenase (EC 1.2.1.72)
 
Vibrio fischeri ES114

Gene: VF_0441: D-erythrose-4-phosphate dehydrogenase (EC 1.2.1.72)
 
Vibrio salmonicida LFI1238

Gene: VSAL_I0555: D-erythrose-4-phosphate dehydrogenase (EC 1.2.1.72)
 
Vibrio angustum S14

Gene: VAS14_20231: D-erythrose-4-phosphate dehydrogenase (EC 1.2.1.72)
*
Photobacterium profundum SS9

Site:
position = -232
score = 5.24351
sequence = TTTAATTTGCAGTGTGAAAAAAA

Gene: PBPRA3132: D-erythrose-4-phosphate dehydrogenase (EC 1.2.1.72)
D-erythrose-4-phosphate dehydrogenase (EC 1.2.1.72)
pgk
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC0477: Phosphoglycerate kinase (EC 2.7.2.3)
*
Vibrio vulnificus CMCP6

Site:
position = -126
score = 5.31839
sequence = TTTATTTTTAGCCTTGAAATAAA

Gene: VV1_1540: Phosphoglycerate kinase (EC 2.7.2.3)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -128
score = 5.29467
sequence = TTTATTTTAAGCCTTGAAATAAA

Gene: VIBHAR_03565: Phosphoglycerate kinase (EC 2.7.2.3)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -128
score = 5.09628
sequence = TTTATTTCAAGCCTTGAAATAAA

Gene: VP2600: Phosphoglycerate kinase (EC 2.7.2.3)
*
Vibrio shilonii AK1

Site:
position = -126
score = 4.54815
sequence = TTAATTTTGATGCTTGAAATTAA

Gene: VSAK1_14330: Phosphoglycerate kinase (EC 2.7.2.3)
*
Vibrio splendidus LGP32

Site:
position = -126
score = 5.56621
sequence = TTTATTTTTTATCTTGAAATAAA

Gene: VS_2646: Phosphoglycerate kinase (EC 2.7.2.3)
*
Vibrio fischeri ES114

Site:
position = -154
score = 4.33926
sequence = GTAAATTTGTGATGAAAAGATAA

Site:
position = -126
score = 4.49467
sequence = ATGAATTTTTATCTTGAAAAAAG

Gene: VF_0442: Phosphoglycerate kinase (EC 2.7.2.3)
*
Vibrio salmonicida LFI1238

Site:
position = -126
score = 5.06747
sequence = ATTAATTTTCACCTTGAAAAAAG

Gene: VSAL_I0556: Phosphoglycerate kinase (EC 2.7.2.3)
 
Vibrio angustum S14

Gene: VAS14_20236: Phosphoglycerate kinase (EC 2.7.2.3)
 
Photobacterium profundum SS9

Gene: PBPRA3131: Phosphoglycerate kinase (EC 2.7.2.3)
Phosphoglycerate kinase (EC 2.7.2.3)
fbaA
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC0478: Fructose-bisphosphate aldolase class II (EC 4.1.2.13)
 
Vibrio vulnificus CMCP6

Gene: VV1_1541: Fructose-bisphosphate aldolase class II (EC 4.1.2.13)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_03564: Fructose-bisphosphate aldolase class II (EC 4.1.2.13)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP2599: Fructose-bisphosphate aldolase class II (EC 4.1.2.13)
 
Vibrio shilonii AK1

Gene: VSAK1_14335: Fructose-bisphosphate aldolase class II (EC 4.1.2.13)
 
Vibrio splendidus LGP32

Gene: VS_2645: Fructose-bisphosphate aldolase class II (EC 4.1.2.13)
 
Vibrio fischeri ES114

Gene: VF_0443: Fructose-bisphosphate aldolase class II (EC 4.1.2.13)
 
Vibrio salmonicida LFI1238

Gene: VSAL_I0557: Fructose-bisphosphate aldolase class II (EC 4.1.2.13)
 
Vibrio angustum S14

Gene: VAS14_20241: Fructose-bisphosphate aldolase class II (EC 4.1.2.13)
 
Photobacterium profundum SS9

Gene: PBPRA3130: Fructose-bisphosphate aldolase class II (EC 4.1.2.13)
Fructose-bisphosphate aldolase class II (EC 4.1.2.13)
 
CRON 9.
ptsH
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -207
score = 5.54426
sequence = TTTATTTTTAGCTTCAAAATAAA

Gene: VC0966: Phosphocarrier protein of PTS system
*
Vibrio vulnificus CMCP6

Site:
position = -204
score = 5.54426
sequence = TTTATTTTTAGCTTCAAAATAAA

Gene: VV1_0210: Phosphocarrier protein of PTS system
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -207
score = 5.54426
sequence = TTTATTTTTAGGTTCAAAATAAA

Gene: VIBHAR_01308: Phosphocarrier protein of PTS system
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -208
score = 5.34587
sequence = TTTATTTCTAGCTTCAAAATAAA

Gene: VP0795: Phosphocarrier protein of PTS system
*
Vibrio shilonii AK1

Site:
position = -207
score = 5.61104
sequence = TTTATTTTAAGCCAAAAAATAAA

Gene: VSAK1_11440: Phosphocarrier protein of PTS system
*
Vibrio splendidus LGP32

Site:
position = -212
score = 5.60586
sequence = TTTATTTTTCGCTTCAAAATAAA

Gene: VS_2290: Phosphocarrier protein of PTS system
*
Vibrio fischeri ES114

Site:
position = -218
score = 5.50829
sequence = TTTATTTTTAGGTGTAAAATAAT

Gene: VF_1894: Phosphocarrier protein of PTS system
*
Vibrio salmonicida LFI1238

Site:
position = -217
score = 5.50829
sequence = TTTATTTTTAGGTGTAAAATAAT

Gene: VSAL_I2357: Phosphocarrier protein of PTS system
*
Vibrio angustum S14

Site:
position = -205
score = 5.01684
sequence = TTTATTTTTAGCTCCGAAATAAA

Gene: VAS14_16916: Phosphocarrier protein of PTS system
*
Photobacterium profundum SS9

Site:
position = -216
score = 5.16306
sequence = TTTATTTTAAGCATCGAAATAAA

Gene: PBPRA0863: Phosphocarrier protein of PTS system
Phosphocarrier protein of PTS system
ptsI
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC0965: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Vibrio vulnificus CMCP6

Gene: VV1_0211: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_01307: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP0794: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Vibrio shilonii AK1

Gene: VSAK1_11445: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Vibrio splendidus LGP32

Gene: VS_2291: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Vibrio fischeri ES114

Gene: VF_1895: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Vibrio salmonicida LFI1238

Gene: VSAL_I2358: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Vibrio angustum S14

Gene: VAS14_16911: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Photobacterium profundum SS9

Gene: PBPRA0862: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
crr
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC0964: PTS system, glucose-specific IIA component (EC 2.7.1.69)
 
Vibrio vulnificus CMCP6

Gene: VV1_0212: PTS system, glucose-specific IIA component (EC 2.7.1.69)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_01306: PTS system, glucose-specific IIA component (EC 2.7.1.69)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP0793: PTS system, glucose-specific IIA component (EC 2.7.1.69)
 
Vibrio shilonii AK1

Gene: VSAK1_08748: PTS system, glucose-specific IIA component (EC 2.7.1.69)
 
Vibrio splendidus LGP32

Gene: VS_2292: PTS system, glucose-specific IIA component (EC 2.7.1.69)
 
Vibrio fischeri ES114

Gene: VF_1897: PTS system, glucose-specific IIA component (EC 2.7.1.69)
 
Vibrio salmonicida LFI1238

Gene: VSAL_I2359: PTS system, glucose-specific IIA component (EC 2.7.1.69)
 
Vibrio angustum S14

Gene: VAS14_16906: PTS system, glucose-specific IIA component (EC 2.7.1.69)
 
Photobacterium profundum SS9

Gene: PBPRA0861: PTS system, glucose-specific IIA component (EC 2.7.1.69)
PTS system, glucose-specific IIA component (EC 2.7.1.69)
 
CRON 10.
chiA
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -120
score = 4.76189
sequence = ATTTTTTTTCGCAAACAAAAAAG

Gene: VCA0027: Chitinase (EC 3.2.1.14)
*
Vibrio vulnificus CMCP6

Site:
position = -122
score = 5.15256
sequence = AATTTTTTTTGCCGAAAAAAAAG

Gene: VV21217: Chitinase (EC 3.2.1.14)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -266
score = 4.81419
sequence = TTTAATTTCACTTGCAAAATAAC

Site:
position = -112
score = 5.44111
sequence = TATTTTTTTTGAAAAAAAATAAG

Gene: VIBHAR_06955: Chitinase (EC 3.2.1.14)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -140
score = 5.12057
sequence = AATTTTTTTTGACGAAAAAAAAC

Gene: VPA0055: Chitinase (EC 3.2.1.14)
*
Vibrio shilonii AK1

Site:
position = -113
score = 4.96427
sequence = TTATTTTTTGAACACAAAATAAA

Gene: VSAK1_11970: Chitinase (EC 3.2.1.14)
*
Vibrio splendidus LGP32

Site:
position = -121
score = 4.93152
sequence = TTTATTTTCAGTCATGAAATTAA

Gene: VS_II1414: Chitinase (EC 3.2.1.14)
*
Vibrio fischeri ES114

Site:
position = -233
score = 4.62987
sequence = CTAAATTCAAAGCACAAATAAAC

Site:
position = -208
score = 4.58236
sequence = CTATTTTTATAAAGCAATAAAAA

Gene: VF_1598: Chitinase (EC 3.2.1.14)
 
Vibrio salmonicida LFI1238
*
Vibrio angustum S14

Site:
position = -97
score = 4.53076
sequence = CATGTTTCTACTTATAAAAAAAG

Gene: VAS14_09224: Chitinase (EC 3.2.1.14)
 
Photobacterium profundum SS9
Chitinase (EC 3.2.1.14)
 
CRON 11.
chiP
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -197
score = 5.36129
sequence = TATTTTTTTAGATAAAAATTAAG

Gene: VC0972: Outer membrane chitoporin
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
*
Vibrio splendidus LGP32

Site:
position = -212
score = 5.32863
sequence = TATTTTTTTAGATGAAAATTAAG

Gene: VS_2285: Outer membrane chitoporin
*
Vibrio fischeri ES114

Site:
position = -237
score = 5.22978
sequence = TATTTTTTTTATTGGAAATTAAG

Gene: VF_1889: Outer membrane chitoporin
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Outer membrane chitoporin
 
CRON 12.
alsR
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -30
score = 5.18822
sequence = TTTATTTTGATATAGAAAATATA

Gene: VC1588: Transcriptional regulator of alpha-acetolactate operon alsR
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Transcriptional regulator of alpha-acetolactate operon alsR
 
CRON 13.
nagE2
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1

Gene: VSAK1_21644: PTS system, N-acetylglucosamine-specific IIA component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)
*
Vibrio splendidus LGP32

Site:
position = -129
score = 4.96356
sequence = GTTTGTTTGCATTAAGAAATAAG

Gene: VS_2186: PTS system, N-acetylglucosamine-specific IIA component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)
*2
Vibrio fischeri ES114

Site:
position = -159
score = 4.79824
sequence = GTTAATTTACGCCTCGAATTAAT

Gene: VF_A0438: PTS system, N-acetylglucosamine-specific IIA component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)

Site:
position = -128
score = 4.50529
sequence = TTTAATTTGCGGGGCGAAATTAA

Gene: VF_0808: PTS system, N-acetylglucosamine-specific IIA component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)
*2
Vibrio salmonicida LFI1238

Site:
position = -160
score = 5.04615
sequence = GTTAATTTACAGCGCAAATAAAC

Gene: VSAL_II0721: PTS system, N-acetylglucosamine-specific IIA component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)

Site:
position = -127
score = 4.50529
sequence = TTTAATTTGCGGGGCGAAATTAA

Site:
position = -86
score = 3.58601
sequence = TTAATAACGAGTAGCGAAATAAG

Gene: VSAL_I0831: PTS system, N-acetylglucosamine-specific IIA component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)
*
Vibrio angustum S14

Site:
position = -201
score = 5.02379
sequence = TTTTTTTCGAATGATAAAATAAG

Site:
position = -107
score = 4.50529
sequence = TTTAATTTGCGGGGCGAAATTAA

Gene: VAS14_17651: PTS system, N-acetylglucosamine-specific IIA component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)
*
Photobacterium profundum SS9

Site:
position = -202
score = 4.96757
sequence = TTTGTTTCGAATCATAAAATAAT

Site:
position = -108
score = 4.79458
sequence = TTTAATTTGCGGAGCGAAATTAA

Gene: PBPRA1032: PTS system, N-acetylglucosamine-specific IIA component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)
PTS system, N-acetylglucosamine-specific IIA component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)
hex
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -130
score = 5.00222
sequence = TTAATTTTGCGCTTAGAAAAAAG

Gene: VC2217: Beta-hexosaminidase (EC 3.2.1.52)
*
Vibrio vulnificus CMCP6

Site:
position = -99
score = 4.92331
sequence = TTAATTTTACGCTTAGAAAAAAC

Gene: VV1_0241: Beta-hexosaminidase (EC 3.2.1.52)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -123
score = 5.04757
sequence = TTAATTTTACGCTTAGAAATAAC

Gene: VIBHAR_01265: Beta-hexosaminidase (EC 3.2.1.52)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -122
score = 5.35503
sequence = TTTATTTTACGCTTAGAAATAAC

Gene: VP0755: Beta-hexosaminidase (EC 3.2.1.52)
 
Vibrio shilonii AK1
*
Vibrio splendidus LGP32

Site:
position = -217
score = 4.32377
sequence = CTCAGTTTTTACGTCAAAATAAA

Site:
position = -97
score = 5.35608
sequence = TTTAATTCACGGCAAAAAATAAG

Gene: VS_0765: Beta-hexosaminidase (EC 3.2.1.52)
*
Vibrio fischeri ES114

Site:
position = -123
score = 5.02542
sequence = AATAATTTATACCGCAAAATATA

Site:
position = -33
score = 3.97068
sequence = TGTAATTCCAGATTCGAAATTAA

Gene: VF_A1010: Beta-hexosaminidase (EC 3.2.1.52)
*
Vibrio salmonicida LFI1238

Site:
position = -202
score = 4.12165
sequence = TTTTTTTTGATTGCCAAATTTAA

Site:
position = -137
score = 4.90658
sequence = TTTAATTTATACCGTGAATTATT

Gene: VSAL_II0050: Beta-hexosaminidase (EC 3.2.1.52)
 
Vibrio angustum S14

Gene: VAS14_17656: Beta-hexosaminidase (EC 3.2.1.52)
 
Photobacterium profundum SS9

Gene: PBPRA1033: Beta-hexosaminidase (EC 3.2.1.52)
Beta-hexosaminidase (EC 3.2.1.52)
nagE1
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -200
score = 5.61265
sequence = GTTTTTTTACATCATAAAATAAG

Site:
position = -106
score = 4.99297
sequence = TTTAATTTGCGGAGCAAAATTAA

Gene: VC0995: PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)
*
Vibrio vulnificus CMCP6

Site:
position = -145
score = 4.99297
sequence = TTTAATTTGCGGAGCAAAATTAA

Gene: VV1_0179: PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -105
score = 4.99297
sequence = TTTAATTTGCGGAGCAAAATTAA

Site:
position = -199
score = 5.46859
sequence = ATTTTTTTGTATAATAAAATAAG

Gene: VIBHAR_01336: PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -199
score = 5.46859
sequence = ATTTTTTTGTATAATAAAATAAG

Site:
position = -105
score = 4.99297
sequence = TTTAATTTGCGGAGCAAAATTAA

Gene: VP0831: PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)
*
Vibrio shilonii AK1

Site:
position = -110
score = 4.99297
sequence = TTTAATTTGCGGAGCAAAATTAA

Site:
position = -68
score = 3.51896
sequence = CTAAATTGAACGGCTAAAATAAG

Gene: VSAK1_10638: PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)
*
Vibrio splendidus LGP32

Site:
position = -73
score = 4.70367
sequence = TTTAATTTGCGGGGCAAAATTAA

Gene: VS_2260: PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 2
Vibrio angustum S14

Gene: VAS14_02456: PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)

Gene: VAS14_11539: PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)
 
Photobacterium profundum SS9

Gene: PBPRB0263: PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)
PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)
 
CRON 14.
chi
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -58
score = 5.09457
sequence = CTTATTTTTCACTATTAAATTAG

Gene: VC0769: Chitinase (EC 3.2.1.14)
*
Vibrio vulnificus CMCP6

Site:
position = -33
score = 4.56569
sequence = CATTTTTTGTGTAGAGAAAAAGG

Gene: VV1_0417: Chitinase (EC 3.2.1.14)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_01081: Chitinase (EC 3.2.1.14)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -149
score = 4.27399
sequence = CATTTTTCTTGTGACAAAATGTG

Gene: VP0619: Chitinase (EC 3.2.1.14)
 
Vibrio shilonii AK1

Gene: VSAK1_12865: Chitinase (EC 3.2.1.14)
 
Vibrio splendidus LGP32

Gene: VS_0630: Chitinase (EC 3.2.1.14)
*
Vibrio fischeri ES114

Site:
position = -39
score = 4.44967
sequence = CTTAATTTCGTTTTTAAATTATC

Gene: VF_1390: Chitinase (EC 3.2.1.14)
 
Vibrio salmonicida LFI1238
*
Vibrio angustum S14

Site:
position = -316
score = 4.20881
sequence = CTTTTTTATAAAAGAGAATCATG

Gene: VAS14_15829: Chitinase (EC 3.2.1.14)
 
Photobacterium profundum SS9

Gene: PBPRA2181: Chitinase (EC 3.2.1.14)
Chitinase (EC 3.2.1.14)
 
CRON 15.
VP1029
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -269
score = 5.34739
sequence = CTTTTTTTTATTAAAAAAATAAC

Gene: VP1029: Hypothetical protein
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Hypothetical protein
tfoX
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -223
score = 4.85985
sequence = ATTAATTTTTATCAGGAAAAATG

Gene: VC1722: DNA transformation protein TfoX
*
Vibrio vulnificus CMCP6

Site:
position = -261
score = 4.36297
sequence = CACATTTTTTATTTGAAAATGTG

Gene: VV1_2136: DNA transformation protein TfoX
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -238
score = 4.22768
sequence = GTTAATTCAATATACGAAGTATC

Gene: VIBHAR_01580: DNA transformation protein TfoX
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP1028: DNA transformation protein TfoX
 
Vibrio shilonii AK1

Gene: VSAK1_04062: DNA transformation protein TfoX
*
Vibrio splendidus LGP32

Site:
position = -340
score = 4.37284
sequence = GTTTTTTTCCTCAACAAACAAAG

Gene: VS_1087: DNA transformation protein TfoX
*
Vibrio fischeri ES114

Site:
position = -104
score = 4.9681
sequence = GTTAATTTTTACGTTAAAATAAC

Gene: VF_1573: DNA transformation protein TfoX
*
Vibrio salmonicida LFI1238

Site:
position = -104
score = 5.24182
sequence = GTTAATTTTTACTTAGAAATAAC

Gene: VSAL_I1982: DNA transformation protein TfoX
*
Vibrio angustum S14

Site:
position = -268
score = 4.33295
sequence = TTAAATTTAATATTAAAAGTATT

Gene: VAS14_03998: DNA transformation protein TfoX
*
Photobacterium profundum SS9

Site:
position = -169
score = 4.72724
sequence = TATTATTTGTGTCTTAAATAATA

Gene: PBPRA2110: DNA transformation protein TfoX
DNA transformation protein TfoX
 
CRON 16.
cbp
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -319
score = 5.12445
sequence = GTTATTTAACTCTAAAAAATAAG

Gene: VCA0811: Chitin binding protein
 
Vibrio vulnificus CMCP6

Gene: VV20044: Chitin binding protein
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_04739: Chitin binding protein
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA1598: Chitin binding protein
*
Vibrio shilonii AK1

Site:
position = -118
score = 4.41328
sequence = CTTATTTTTCCACTCTAAATTAC

Gene: VSAK1_17082: Chitin binding protein
 
Vibrio splendidus LGP32
*
Vibrio fischeri ES114

Site:
position = -210
score = 4.85346
sequence = TTTATTTCTTTATTTACAATAAG

Gene: VF_A0143: Chitin binding protein
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0134: Chitin binding protein
 
Vibrio angustum S14
*
Photobacterium profundum SS9

Site:
position = -30
score = 4.6999
sequence = GTTGTTTTTTTCTATAAAACAAC

Gene: PBPRB0312: Chitin binding protein
Chitin binding protein
 
CRON 17.
mcp
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -144
score = 4.92099
sequence = TTTATTTCGAGGCAAAAATTTAA

Site:
position = -102
score = 4.74463
sequence = CTTACTTCGTATCAATAAATAAG

Gene: VC0449: N-acetylglucosamine regulated methyl-accepting chemotaxis protein
*2
Vibrio vulnificus CMCP6

Site:
position = -148
score = 4.9677
sequence = CTTTTTTCACGCTATAAATTTAA

Gene: VV1_1511: N-acetylglucosamine regulated methyl-accepting chemotaxis protein

Gene: VV1_1510: N-acetylglucosamine regulated methyl-accepting chemotaxis protein
 
Vibrio harveyi ATCC BAA-1116
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -148
score = 5.11569
sequence = CTTATTTCACGCTAAAAATTTAA

Gene: VP2629: N-acetylglucosamine regulated methyl-accepting chemotaxis protein
 
Vibrio shilonii AK1
*
Vibrio splendidus LGP32

Site:
position = -128
score = 5.08455
sequence = CTTTTTTTTCTTCGTAAATTTAA

Gene: VS_2703: N-acetylglucosamine regulated methyl-accepting chemotaxis protein
*
Vibrio fischeri ES114

Site:
position = -273
score = 4.2759
sequence = TTTTATTTAAGATTTAATTCAAA

Gene: VF_2161: N-acetylglucosamine regulated methyl-accepting chemotaxis protein
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
N-acetylglucosamine regulated methyl-accepting chemotaxis protein
 
CRON 18.
tfoX1
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -135
score = 4.68398
sequence = CTTATTTCTCTTCGTAAACTATC

Gene: VC1153: DNA transformation protein TfoX1 (Sxy)
*
Vibrio vulnificus CMCP6

Site:
position = -150
score = 4.63891
sequence = CTTATTTTTTTTCATTAAGTATG

Gene: VV1_2820: DNA transformation protein TfoX1 (Sxy)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -152
score = 4.73267
sequence = CTTATTTTTCAACGTTAAGTATG

Gene: VIBHAR_02628: DNA transformation protein TfoX1 (Sxy)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -151
score = 4.73267
sequence = CTTATTTTTCAACGTTAAGTATG

Gene: VP1241: DNA transformation protein TfoX1 (Sxy)
*
Vibrio shilonii AK1

Site:
position = -155
score = 4.80171
sequence = CTTATTTTGCATTGTGAACTATT

Gene: VSAK1_06295: DNA transformation protein TfoX1 (Sxy)
*
Vibrio splendidus LGP32

Site:
position = -155
score = 4.68025
sequence = CTTATTTTTCTTTTCGAAGTATC

Gene: VS_1829: DNA transformation protein TfoX1 (Sxy)
*
Vibrio fischeri ES114

Site:
position = -136
score = 4.58618
sequence = CTTGTTTCGTTACATGAATTAAT

Gene: VF_0896: DNA transformation protein TfoX1 (Sxy)
 
Vibrio salmonicida LFI1238
*
Vibrio angustum S14

Site:
position = -179
score = 5.42427
sequence = ATTATTTTGCGACAAAAAATATG

Gene: VAS14_05168: DNA transformation protein TfoX1 (Sxy)
*
Photobacterium profundum SS9

Site:
position = -163
score = 4.80936
sequence = CTTATTTCGCGTTAAATAATATG

Gene: PBPRA1207: DNA transformation protein TfoX1 (Sxy)
DNA transformation protein TfoX1 (Sxy)
 
CRON 19.
VF_2510
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
*
Vibrio fischeri ES114

Site:
position = -128
score = 4.7274
sequence = TATATTTTTCAATAAAATAAATT

Gene: VF_2510: Putative BglB-family transcriptional antiterminator
*
Vibrio salmonicida LFI1238

Site:
position = -80
score = 5.4062
sequence = CTTATTTTTAGTCGAAAAAAATA

Gene: VSAL_I0103: Putative BglB-family transcriptional antiterminator
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Putative BglB-family transcriptional antiterminator
 
CRON 20.
gapB
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0843: NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
 
Vibrio vulnificus CMCP6

Gene: VV20764: NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_05341: NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA1230: NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
*
Vibrio shilonii AK1

Site:
position = -267
score = 4.51319
sequence = CTTGATTGAATGCGAAAAATAAG

Gene: VSAK1_05950: NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
*
Vibrio splendidus LGP32

Site:
position = -316
score = 4.89002
sequence = AGTATTTTTTGGCGAAAATTAAG

Gene: VS_II0346: NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14

Gene: VAS14_13644: NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
*
Photobacterium profundum SS9

Site:
position = -250
score = 5.34386
sequence = CTTATATTTCATCAAAAAATAAG

Gene: PBPRA1724: NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
 
CRON 21.
glgC
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1727: Glucose-1-phosphate adenylyltransferase (EC 2.7.7.27)
 
Vibrio vulnificus CMCP6

Gene: VV1_2131: Glucose-1-phosphate adenylyltransferase (EC 2.7.7.27)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -197
score = 4.84094
sequence = GTTATTTAGCGCCAAAAATAAAG

Gene: VIBHAR_01575: Glucose-1-phosphate adenylyltransferase (EC 2.7.7.27)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -192
score = 5.28835
sequence = TTTATTTAGCGTCAAAAAATAAG

Gene: VP1023: Glucose-1-phosphate adenylyltransferase (EC 2.7.7.27)
*
Vibrio shilonii AK1

Site:
position = -231
score = 4.67672
sequence = CTTATTTCAAAACGATAATTTAG

Gene: VSAK1_04037: Glucose-1-phosphate adenylyltransferase (EC 2.7.7.27)
 
Vibrio splendidus LGP32

Gene: VS_1082: Glucose-1-phosphate adenylyltransferase (EC 2.7.7.27)
 
Vibrio fischeri ES114

Gene: VF_A0806: Glucose-1-phosphate adenylyltransferase (EC 2.7.7.27)
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0238: Glucose-1-phosphate adenylyltransferase (EC 2.7.7.27)
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRB0405: Glucose-1-phosphate adenylyltransferase (EC 2.7.7.27)
Glucose-1-phosphate adenylyltransferase (EC 2.7.7.27)
glgA
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1726: Glycogen synthase, ADP-glucose transglucosylase (EC 2.4.1.21)
 
Vibrio vulnificus CMCP6

Gene: VV1_2132: Glycogen synthase, ADP-glucose transglucosylase (EC 2.4.1.21)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_01576: Glycogen synthase, ADP-glucose transglucosylase (EC 2.4.1.21)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP1024: Glycogen synthase, ADP-glucose transglucosylase (EC 2.4.1.21)
 
Vibrio shilonii AK1

Gene: VSAK1_04042: Glycogen synthase, ADP-glucose transglucosylase (EC 2.4.1.21)
 
Vibrio splendidus LGP32

Gene: VS_1083: Glycogen synthase, ADP-glucose transglucosylase (EC 2.4.1.21)
 
Vibrio fischeri ES114

Gene: VF_A0805: Glycogen synthase, ADP-glucose transglucosylase (EC 2.4.1.21)
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0239: Glycogen synthase, ADP-glucose transglucosylase (EC 2.4.1.21)
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRB0406: Glycogen synthase, ADP-glucose transglucosylase (EC 2.4.1.21)
Glycogen synthase, ADP-glucose transglucosylase (EC 2.4.1.21)
 
CRON 22.
glmU
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC2762: N-acetylglucosamine-1-phosphate uridyltransferase (EC 2.7.7.23) / Glucosamine-1-phosphate N-acetyltransferase (EC 2.3.1.157)
*
Vibrio vulnificus CMCP6

Site:
position = -101
score = 4.79748
sequence = CTTAATTTTTATTAGAAATTTTT

Gene: VV1_1023: N-acetylglucosamine-1-phosphate uridyltransferase (EC 2.7.7.23) / Glucosamine-1-phosphate N-acetyltransferase (EC 2.3.1.157)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -97
score = 4.90604
sequence = ATTAATTTTAGTTGTAAATTTAC

Gene: VIBHAR_00419: N-acetylglucosamine-1-phosphate uridyltransferase (EC 2.7.7.23) / Glucosamine-1-phosphate N-acetyltransferase (EC 2.3.1.157)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -97
score = 4.81422
sequence = ATTATTTTTAGTTGGAAATTTAC

Gene: VP3067: N-acetylglucosamine-1-phosphate uridyltransferase (EC 2.7.7.23) / Glucosamine-1-phosphate N-acetyltransferase (EC 2.3.1.157)
*2
Vibrio shilonii AK1

Site:
position = -88
score = 5.02719
sequence = CTTAATTTTTATTAGAAATTTAC

Gene: VSAK1_24585: N-acetylglucosamine-1-phosphate uridyltransferase (EC 2.7.7.23) / Glucosamine-1-phosphate N-acetyltransferase (EC 2.3.1.157)

Gene: VSAK1_15437: N-acetylglucosamine-1-phosphate uridyltransferase (EC 2.7.7.23) / Glucosamine-1-phosphate N-acetyltransferase (EC 2.3.1.157)
 
Vibrio splendidus LGP32

Gene: VS_3150: N-acetylglucosamine-1-phosphate uridyltransferase (EC 2.7.7.23) / Glucosamine-1-phosphate N-acetyltransferase (EC 2.3.1.157)
 
Vibrio fischeri ES114

Gene: VF_2562: N-acetylglucosamine-1-phosphate uridyltransferase (EC 2.7.7.23) / Glucosamine-1-phosphate N-acetyltransferase (EC 2.3.1.157)
 
Vibrio salmonicida LFI1238

Gene: VSAL_I3057: N-acetylglucosamine-1-phosphate uridyltransferase (EC 2.7.7.23) / Glucosamine-1-phosphate N-acetyltransferase (EC 2.3.1.157)
*
Vibrio angustum S14

Site:
position = -201
score = 4.47836
sequence = CTTTTTTTATGGCTAAAATCTTA

Site:
position = -105
score = 5.19706
sequence = GTTATTTCTTAGTGAGAATTAAA

Gene: VAS14_22517: N-acetylglucosamine-1-phosphate uridyltransferase (EC 2.7.7.23) / Glucosamine-1-phosphate N-acetyltransferase (EC 2.3.1.157)
 2
Photobacterium profundum SS9

Gene: PBPRA3601: N-acetylglucosamine-1-phosphate uridyltransferase (EC 2.7.7.23) / Glucosamine-1-phosphate N-acetyltransferase (EC 2.3.1.157)

Gene: PBPRA1987: N-acetylglucosamine-1-phosphate uridyltransferase (EC 2.7.7.23) / Glucosamine-1-phosphate N-acetyltransferase (EC 2.3.1.157)
N-acetylglucosamine-1-phosphate uridyltransferase (EC 2.7.7.23) / Glucosamine-1-phosphate N-acetyltransferase (EC 2.3.1.157)
 
CRON 23.
aldC
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -98
score = 5.18822
sequence = TATATTTTCTATATCAAAATAAA

Gene: VC1589: Alpha-acetolactate decarboxylase (EC 4.1.1.5)
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14

Gene: VAS14_04523: Alpha-acetolactate decarboxylase (EC 4.1.1.5)
 
Photobacterium profundum SS9
Alpha-acetolactate decarboxylase (EC 4.1.1.5)
budB
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1590: Acetolactate synthase, catabolic (EC 2.2.1.6)
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Acetolactate synthase, catabolic (EC 2.2.1.6)
VC1591
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1591: Oxidoreductase, short-chain dehydrogenase/reductase family
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Oxidoreductase, short-chain dehydrogenase/reductase family
 
CRON 24.
VF_1011
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114

Gene: VF_1011: Outer membrane protein
*
Vibrio salmonicida LFI1238

Site:
position = -283
score = 5.11648
sequence = CTTTTTTTTATATGTAAATTTAG

Gene: VSAL_I1132: Outer membrane protein
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Outer membrane protein
 
CRON 25.
ompC
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6

Gene: VV21143: Predicted OmpC-like chitoporin
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA1745: Predicted OmpC-like chitoporin
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
*
Vibrio fischeri ES114

Site:
position = -283
score = 4.79722
sequence = GTTATTTTGTGATGTAAACCAAG

Site:
position = -143
score = 4.7766
sequence = TTAATTTTGTGAAGCGAATTAAT

Gene: VF_1795: Predicted OmpC-like chitoporin
*
Vibrio salmonicida LFI1238

Site:
position = -342
score = 5.02804
sequence = CCTTTTTTGTTATAAAAATTAAG

Site:
position = -145
score = 4.7245
sequence = TTAATTTTGCAGAGCGAATTAAT

Gene: VSAL_I2182: Predicted OmpC-like chitoporin
 
Vibrio angustum S14
*
Photobacterium profundum SS9

Site:
position = -338
score = 4.88021
sequence = CATAATTCGCGATAAAAAAATAG

Site:
position = -293
score = 5.10879
sequence = ATTATTTCACGGCGTGAAATAAG

Gene: PBPRA2790: Predicted OmpC-like chitoporin
Predicted OmpC-like chitoporin
 
CRON 26.
chiD
*2
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -357
score = 5.16667
sequence = TTTTATTTATGATCAAAAATAAA

Gene: VC1073: Chitodextrinase precursor (EC 3.2.1.14)

Site:
position = -227
score = 5.14985
sequence = CTTTTTTTATGGTGAAAAATTTA

Site:
position = -42
score = 4.50677
sequence = TTTATTTAATGGTTGAAATAATA

Gene: VCA0700: Chitodextrinase precursor (EC 3.2.1.14)
*
Vibrio vulnificus CMCP6

Site:
position = -172
score = 4.62987
sequence = ATTAGTTATCGGTACAAAATAAG

Site:
position = -58
score = 5.08249
sequence = GTTATTTTACAGCGAAATATAAG

Gene: VV20213: Chitodextrinase precursor (EC 3.2.1.14)
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Chitodextrinase precursor (EC 3.2.1.14)
 
CRON 27.
VV21298
 
Vibrio cholerae O1 biovar eltor str. N16961
*
Vibrio vulnificus CMCP6

Site:
position = -71
score = 5.09748
sequence = CTTTTTTTAAAACAAAAAGAAAG

Gene: VV21298: hypothetical protein
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
hypothetical protein
VV21300
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6

Gene: VV21300: Beta-glucanase precursor (EC 3.2.1.73)
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Beta-glucanase precursor (EC 3.2.1.73)
 
CRON 28.
VV20680
 
Vibrio cholerae O1 biovar eltor str. N16961
*
Vibrio vulnificus CMCP6

Site:
position = -290
score = 5.1033
sequence = TTTATTTTAAAAATAGAAATATC

Gene: VV20680: Permease of the major facilitator superfamily
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Permease of the major facilitator superfamily
VV20681
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6

Gene: VV20681: Hypothetical protein
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Hypothetical protein
 
CRON 29.
ompU
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
*
Vibrio shilonii AK1

Site:
position = -195
score = 5.0931
sequence = CCTATTTTTAAATATAAATTAAT

Gene: VSAK1_16967: Outer membrane protein OmpU
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14

Gene: VAS14_08970: Outer membrane protein OmpU
 
Photobacterium profundum SS9
Outer membrane protein OmpU
 
CRON 30.
chiS
 
Vibrio cholerae O1 biovar eltor str. N16961
*
Vibrio vulnificus CMCP6

Site:
position = -149
score = 4.5569
sequence = CTTACTTGTCAAAGTAAAAAAAC

Gene: VV1_1674: Chitin catabolic cascade sensor histidine kinase ChiS
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
*
Vibrio fischeri ES114

Site:
position = -131
score = 5.02594
sequence = CTTGATTTTTAACATGAATTAAG

Gene: VF_2138: Chitin catabolic cascade sensor histidine kinase ChiS
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Chitin catabolic cascade sensor histidine kinase ChiS
 
CRON 31.
nagB
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -109
score = 5.61976
sequence = CTTATTTTATAATGCAAATTAAC

Gene: VCA1025: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Vibrio vulnificus CMCP6

Site:
position = -64
score = 5.71927
sequence = CTTATTTTATAATGCAAAATAAT

Gene: VV21200: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -63
score = 5.57464
sequence = CTTATTTTATAATGCAAATTAAT

Gene: VIBHAR_07002: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -231
score = 4.63407
sequence = CTTAATTCAAGCCATAAATTTTA

Site:
position = -63
score = 5.37625
sequence = CTTATTTTATAATGCGAATTAAT

Gene: VPA0038: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Vibrio shilonii AK1

Site:
position = -62
score = 5.37625
sequence = CTTATTTTATAATGCGAATTAAT

Gene: VSAK1_20854: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Vibrio splendidus LGP32

Site:
position = -64
score = 5.37625
sequence = CTTATTTTATAATGCGAATTAAT

Gene: VS_II1435: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Vibrio fischeri ES114

Site:
position = -65
score = 5.37625
sequence = CTTATTTTATAATGCGAATTAAT

Gene: VF_2357: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Vibrio salmonicida LFI1238

Site:
position = -64
score = 5.3887
sequence = CTTATTTTACAATGCGAATTAAC

Gene: VSAL_I2812: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Vibrio angustum S14

Site:
position = -172
score = 4.50529
sequence = TTAATTTCGCCCCGCAAATTAAA

Site:
position = -78
score = 5.02379
sequence = CTTATTTTATCATTCGAAAAAAA

Gene: VAS14_17646: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*2
Photobacterium profundum SS9

Site:
position = -171
score = 4.79458
sequence = TTAATTTCGCTCCGCAAATTAAA

Site:
position = -77
score = 4.96757
sequence = ATTATTTTATGATTCGAAACAAA

Gene: PBPRA1031: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)

Site:
position = -60
score = 5.46002
sequence = CTTATTTTACAATGAAAATAATG

Gene: PBPRB0360: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
nagA
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -291
score = 5.61265
sequence = CTTATTTTATGATGTAAAAAAAC

Gene: VC0994: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
*
Vibrio vulnificus CMCP6

Site:
position = -317
score = 5.08503
sequence = CTTATTTTATCATTCAAAAAAAT

Gene: VV1_0180: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -313
score = 5.46859
sequence = CTTATTTTATTATACAAAAAAAT

Gene: VIBHAR_01335: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -313
score = 5.46859
sequence = CTTATTTTATTATACAAAAAAAT

Gene: VP0829: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
*
Vibrio shilonii AK1

Site:
position = -291
score = 4.98091
sequence = CTTATTTTATCATACGAAAAAAT

Gene: VSAK1_10643: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
*
Vibrio splendidus LGP32

Site:
position = -295
score = 5.08503
sequence = CTTATTTTATCATTCAAAAAAAT

Gene: VS_2261: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
*2
Vibrio fischeri ES114

Gene: VF_0665: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)

Site:
position = -40
score = 4.70095
sequence = TTTTTTTCGTACTCTAAATTATA

Gene: VF_0807: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
*
Vibrio salmonicida LFI1238

Site:
position = -297
score = 4.50529
sequence = TTAATTTCGCCCCGCAAATTAAA

Site:
position = -41
score = 4.82674
sequence = TTTTTTTTGTATACTAAATTATA

Gene: VSAL_I0830: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
*2
Vibrio angustum S14

Site:
position = -149
score = 5.41141
sequence = CTTAATTCACATAGAAAAATAAG

Gene: VAS14_11739: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)

Gene: VAS14_17641: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
*2
Photobacterium profundum SS9

Site:
position = -131
score = 5.29965
sequence = CTTATTTTCTATCGAGAATTAAG

Gene: PBPRB0765: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)

Gene: PBPRA1030: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
nagC
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC0993: N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
 
Vibrio vulnificus CMCP6

Gene: VV1_0181: N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_01334: N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP0828: N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
 
Vibrio shilonii AK1

Gene: VSAK1_10648: N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
 
Vibrio splendidus LGP32

Gene: VS_2262: N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
 
Vibrio fischeri ES114

Gene: VF_0806: N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
 
Vibrio salmonicida LFI1238

Gene: VSAL_I0829: N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
 
Vibrio angustum S14

Gene: VAS14_17636: N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
 
Photobacterium profundum SS9

Gene: PBPRA1029: N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
 
CRON 32.
gapA
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -39
score = 4.67288
sequence = GTTATCTTTAATCAGAAATTAAG

Gene: VC2000: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
*
Vibrio vulnificus CMCP6

Site:
position = -39
score = 4.67288
sequence = GTTATCTTTAATCAGAAATTAAG

Gene: VV1_3140: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -39
score = 4.67288
sequence = GTTATCTTTAATCAGAAATTAAG

Gene: VIBHAR_03049: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -39
score = 4.67288
sequence = GTTATCTTTAATCAGAAATTAAG

Gene: VP2157: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Vibrio shilonii AK1

Gene: VSAK1_10028: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114

Gene: VF_0913: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
*
Vibrio salmonicida LFI1238

Site:
position = -124
score = 4.67957
sequence = GTTATTTTTTGATTTTAAACAAT

Gene: VSAL_I1849: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Vibrio angustum S14
 
Photobacterium profundum SS9
NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
aldE
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC2001: Aldose 1-epimerase
 
Vibrio vulnificus CMCP6

Gene: VV1_3141: Aldose 1-epimerase
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_03050: Aldose 1-epimerase
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP2158: Aldose 1-epimerase
 
Vibrio shilonii AK1

Gene: VSAK1_10033: Aldose 1-epimerase
 
Vibrio splendidus LGP32

Gene: VS_0931: Aldose 1-epimerase
 
Vibrio fischeri ES114

Gene: VF_0912: Aldose 1-epimerase
 
Vibrio salmonicida LFI1238

Gene: VSAL_I1848: Aldose 1-epimerase
*
Vibrio angustum S14

Site:
position = -104
score = 5.39528
sequence = GATATTTTAAAGCGAAAAATAAG

Gene: VAS14_06018: Aldose 1-epimerase
*
Photobacterium profundum SS9

Site:
position = -108
score = 5.5055
sequence = GATATTTTTAAACGAAAAATAAG

Gene: PBPRA2603: Aldose 1-epimerase
Aldose 1-epimerase
 
CRON 33.
ybfM
 
Vibrio cholerae O1 biovar eltor str. N16961
*2
Vibrio vulnificus CMCP6

Gene: VV21097: N-acetylglucosamine-regulated outer membrane porin

Site:
position = -211
score = 5.34684
sequence = TATTTTTTTAGAAAAAAAATAAG

Gene: VV1_0205: N-acetylglucosamine-regulated outer membrane porin
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -212
score = 5.34684
sequence = TATTTTTTTAGAAAAAAAATAAG

Gene: VIBHAR_01313: N-acetylglucosamine-regulated outer membrane porin
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -209
score = 5.34684
sequence = TATTTTTTTAGAAAAAAAATAAG

Gene: VP0802: N-acetylglucosamine-regulated outer membrane porin
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14

Gene: VAS14_16941: N-acetylglucosamine-regulated outer membrane porin
*2
Photobacterium profundum SS9

Site:
position = -105
score = 4.89735
sequence = TATTTTTCGAAGAATAAATTAAG

Gene: PBPRA0868: N-acetylglucosamine-regulated outer membrane porin

Gene: PBPRA0872: N-acetylglucosamine-regulated outer membrane porin
N-acetylglucosamine-regulated outer membrane porin
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD