Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Irr - Rhodospirillales

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Heme
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 13 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Rhodospirillum rubrum ATCC 11170 3 2
Magnetospirillum magnetotacticum MS-1 4 4
Magnetospirillum magneticum AMB-1 1 1
Azospirillum sp. B510 1 1
Rhodospirillum centenum SW 4 4
Gluconacetobacter diazotrophicus PAl 5
Acetobacter pasteurianus IFO 3283-01
Gluconobacter oxydans 621H
Granulibacter bethesdensis CGDNIH1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
sufS2
 
Rhodospirillum rubrum ATCC 11170
*
Magnetospirillum magnetotacticum MS-1

Site:
position = -205
score = 5.04377
sequence = CTCTTAGAATAATTCTAGACG

Site:
position = -186
score = 6.06644
sequence = CGATTAGAACTATTCTAAACT

Gene: Magn03001119: Cysteine desulfurase (EC 2.8.1.7)
 
Magnetospirillum magneticum AMB-1
 
Azospirillum sp. B510
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
Cysteine desulfurase (EC 2.8.1.7)
 
CRON 2.
ccpA
*
Rhodospirillum rubrum ATCC 11170

Site:
position = -96
score = 4.27796
sequence = TTCCTAGAGCAATTCCAATAT

Gene: Rru_A1789: Cytochrome c551 peroxidase (EC 1.11.1.5)
 
Magnetospirillum magnetotacticum MS-1
*
Magnetospirillum magneticum AMB-1

Site:
position = -164
score = 5.06972
sequence = GAGTTAGAAGAATTCTAAATA

Gene: amb2822: Cytochrome c551 peroxidase (EC 1.11.1.5)
*
Azospirillum sp. B510

Site:
position = -173
score = 6.00017
sequence = AGTTTAGAATAATTCCAGATT

Gene: AZL_001890: Cytochrome c551 peroxidase (EC 1.11.1.5)
*
Rhodospirillum centenum SW

Site:
position = -77
score = 4.57791
sequence = TCTTTAGATTTATTCAAGATC

Gene: RC1_3828: Cytochrome c551 peroxidase (EC 1.11.1.5)
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
Cytochrome c551 peroxidase (EC 1.11.1.5)
 
CRON 3.
dps
 
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A0333: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
 
Magnetospirillum magnetotacticum MS-1
 
Magnetospirillum magneticum AMB-1
 
Azospirillum sp. B510

Gene: AZL_002060: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
*2
Rhodospirillum centenum SW

Site:
position = -63
score = 5.71345
sequence = AACTTGGAAGAATTCTAAACT

Gene: RC1_1876: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)

Gene: RC1_1875: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
 
CRON 4.
fhuA
 
Rhodospirillum rubrum ATCC 11170
*
Magnetospirillum magnetotacticum MS-1

Site:
position = -180
score = 4.92125
sequence = AAATAAGAATAATTCTATACA

Gene: Magn03006487: Ferrichrome-iron outer membrane receptor
 
Magnetospirillum magneticum AMB-1
 
Azospirillum sp. B510
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
Ferrichrome-iron outer membrane receptor
 
CRON 5.
irr
 
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A3788: Iron-responsive regulator Irr
*
Magnetospirillum magnetotacticum MS-1

Site:
position = -61
score = 4.10496
sequence = TTTTTCGAACGACTCCATGTT

Gene: Magn03009205: Iron-responsive regulator Irr
 
Magnetospirillum magneticum AMB-1

Gene: amb4306: Iron-responsive regulator Irr
 
Azospirillum sp. B510

Gene: AZL_026170: Iron-responsive regulator Irr
*
Rhodospirillum centenum SW

Site:
position = -104
score = 4.65784
sequence = GGCCTTGAATTGTTCCAAATA

Gene: RC1_2944: Iron-responsive regulator Irr
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
Iron-responsive regulator Irr
 
CRON 6.
bfd
*
Rhodospirillum rubrum ATCC 11170

Site:
position = -43
score = 4.80991
sequence = GGTTTTGAGTGGTTTTAATCT

Gene: Rru_A2196: bacterioferritin-associated ferredoxin
 
Magnetospirillum magnetotacticum MS-1

Gene: Magn03008031: bacterioferritin-associated ferredoxin
 
Magnetospirillum magneticum AMB-1
 
Azospirillum sp. B510

Gene: AZL_011850: bacterioferritin-associated ferredoxin
 
Rhodospirillum centenum SW

Gene: RC1_3427: bacterioferritin-associated ferredoxin
 
Gluconacetobacter diazotrophicus PAl 5

Gene: Gdia_2924: bacterioferritin-associated ferredoxin
 
Acetobacter pasteurianus IFO 3283-01

Gene: APA01_04500: bacterioferritin-associated ferredoxin
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
bacterioferritin-associated ferredoxin
bfr
 
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A2195: Bacterioferritin (cytochrome b1)
*
Magnetospirillum magnetotacticum MS-1

Site:
position = -156
score = 5.59555
sequence = AGTTTGGGATCATTCCAAACT

Gene: Magn03005274: Bacterioferritin (cytochrome b1)
 
Magnetospirillum magneticum AMB-1
 
Azospirillum sp. B510
*
Rhodospirillum centenum SW

Site:
position = -48
score = 4.44337
sequence = GTTTTAAACTCGTTCCAGACT

Gene: RC1_3428: Bacterioferritin (cytochrome b1)
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
Bacterioferritin (cytochrome b1)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD