Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Irr - Rhodobacterales

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Heme
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 37 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Rhodobacter sphaeroides 2.4.1 2 2
Paracoccus denitrificans PD1222
Jannaschia sp. CCS1 14 3
Rhodobacterales bacterium HTCC2654 4 3
Oceanicola granulosus HTCC2516 10 1
Loktanella vestfoldensis SKA53 11 4
Oceanicola batsensis HTCC2597 12 3
Roseovarius nubinhibens ISM 16 4
Roseovarius sp. 217 13 4
Sulfitobacter sp. EE-36 13 4
Silicibacter TM1040 12 3
Silicibacter pomeroyi DSS-3 4 4
Roseobacter sp. MED193 12 2
Hyphomonas neptunium ATCC 15444
Oceanicaulis alexandrii HTCC2633
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
iscR
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_0443: Iron-sulfur cluster regulator IscR
 
Paracoccus denitrificans PD1222

Gene: Pden_2958: Iron-sulfur cluster regulator IscR
*
Jannaschia sp. CCS1

Site:
position = -137
score = 5.18857
sequence = ACCCTAGAACGATTCCAAATT

Gene: Jann_2366: Iron-sulfur cluster regulator IscR
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_04009: Iron-sulfur cluster regulator IscR
*
Oceanicola granulosus HTCC2516

Site:
position = -131
score = 6.318
sequence = TGTTTAGAAGTGTTCTAAACT

Gene: OG2516_03700: Iron-sulfur cluster regulator IscR
*
Loktanella vestfoldensis SKA53

Site:
position = -111
score = 5.86635
sequence = ACCTTAGAAGGATTCTAAACT

Gene: SKA53_05183: Iron-sulfur cluster regulator IscR
*
Oceanicola batsensis HTCC2597

Site:
position = -114
score = 5.03496
sequence = ACCTTAGAAAGATTCTAAAGC

Gene: OB2597_03589: Iron-sulfur cluster regulator IscR
*
Roseovarius nubinhibens ISM

Site:
position = -129
score = 6.34207
sequence = ACTTTAGAACTGTTCTAAACA

Gene: ISM_16015: Iron-sulfur cluster regulator IscR
*
Roseovarius sp. 217

Site:
position = -100
score = 5.96286
sequence = ACCTTAGAACTGTTCTAAATT

Gene: ROS217_20542: Iron-sulfur cluster regulator IscR
*
Sulfitobacter sp. EE-36

Site:
position = -116
score = 5.90335
sequence = AGTTTAGAACGGTTCTAACTT

Gene: EE36_14302: Iron-sulfur cluster regulator IscR
*
Silicibacter TM1040

Site:
position = -117
score = 5.69427
sequence = ACCTTAGAACTGTTCTAAAGA

Gene: TM1040_1240: Iron-sulfur cluster regulator IscR
*
Silicibacter pomeroyi DSS-3

Site:
position = -121
score = 5.24073
sequence = ATCTTAGAATGGTTCTAAGTC

Gene: SPO2025: Iron-sulfur cluster regulator IscR
*
Roseobacter sp. MED193

Site:
position = -124
score = 5.31165
sequence = ATCTTAGAACAATTCTAATTG

Gene: MED193_04321: Iron-sulfur cluster regulator IscR
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_03246: Iron-sulfur cluster regulator IscR
Iron-sulfur cluster regulator IscR
sufS
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_0442: Cysteine desulfurase (EC 2.8.1.7)
 
Paracoccus denitrificans PD1222

Gene: Pden_3963: Cysteine desulfurase (EC 2.8.1.7)
 
Jannaschia sp. CCS1

Gene: Jann_2365: Cysteine desulfurase (EC 2.8.1.7)
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_04004: Cysteine desulfurase (EC 2.8.1.7)
 
Oceanicola granulosus HTCC2516

Gene: OG2516_03695: Cysteine desulfurase (EC 2.8.1.7)
 
Loktanella vestfoldensis SKA53

Gene: SKA53_05178: Cysteine desulfurase (EC 2.8.1.7)
 
Oceanicola batsensis HTCC2597

Gene: OB2597_03584: Cysteine desulfurase (EC 2.8.1.7)
 
Roseovarius nubinhibens ISM

Gene: ISM_16010: Cysteine desulfurase (EC 2.8.1.7)
 
Roseovarius sp. 217

Gene: ROS217_20537: Cysteine desulfurase (EC 2.8.1.7)
 
Sulfitobacter sp. EE-36

Gene: EE36_14307: Cysteine desulfurase (EC 2.8.1.7)
 
Silicibacter TM1040

Gene: TM1040_1241: Cysteine desulfurase (EC 2.8.1.7)
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193

Gene: MED193_04316: Cysteine desulfurase (EC 2.8.1.7)
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_2620: Cysteine desulfurase (EC 2.8.1.7)
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_03241: Cysteine desulfurase (EC 2.8.1.7)
Cysteine desulfurase (EC 2.8.1.7)
sufB
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_0440: Iron-sulfur assembly protein SufB
 
Paracoccus denitrificans PD1222

Gene: Pden_3964: Iron-sulfur assembly protein SufB
 
Jannaschia sp. CCS1

Gene: Jann_2364: Iron-sulfur assembly protein SufB
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_03999: Iron-sulfur assembly protein SufB
 
Oceanicola granulosus HTCC2516

Gene: OG2516_03690: Iron-sulfur assembly protein SufB
 
Loktanella vestfoldensis SKA53

Gene: SKA53_05173: Iron-sulfur assembly protein SufB
 
Oceanicola batsensis HTCC2597

Gene: OB2597_03579: Iron-sulfur assembly protein SufB
 
Roseovarius nubinhibens ISM

Gene: ISM_16005: Iron-sulfur assembly protein SufB
 
Roseovarius sp. 217

Gene: ROS217_20532: Iron-sulfur assembly protein SufB
 
Sulfitobacter sp. EE-36

Gene: EE36_14312: Iron-sulfur assembly protein SufB
 
Silicibacter TM1040

Gene: TM1040_1242: Iron-sulfur assembly protein SufB
 
Silicibacter pomeroyi DSS-3

Gene: SPO2023: Iron-sulfur assembly protein SufB
 
Roseobacter sp. MED193

Gene: MED193_04311: Iron-sulfur assembly protein SufB
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_2619: Iron-sulfur assembly protein SufB
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_03236: Iron-sulfur assembly protein SufB
Iron-sulfur assembly protein SufB
ISM_16000
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM

Gene: ISM_16000: hypothetical protein
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
hypothetical protein
PF02475
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 2
Jannaschia sp. CCS1

Gene: Jann_2362: Methyltransferase FkbM

Gene: Jann_2360: Methyltransferase FkbM
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516

Gene: OG2516_03685: Methyltransferase FkbM
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM

Gene: ISM_15995: Methyltransferase FkbM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040

Gene: TM1040_1244: Methyltransferase FkbM
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Methyltransferase FkbM
ISM_15990
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM

Gene: ISM_15990: hypothetical protein
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
hypothetical protein
PF02475
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516

Gene: OG2516_11676: Protein of unknown function Met10
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597

Gene: OB2597_19321: Protein of unknown function Met10
 
Roseovarius nubinhibens ISM

Gene: ISM_15985: Protein of unknown function Met10
 2
Roseovarius sp. 217

Gene: ROS217_06585: Protein of unknown function Met10

Gene: ROS217_13371: Protein of unknown function Met10
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_06359: Protein of unknown function Met10
Protein of unknown function Met10
PDB:3cvoA
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516

Gene: OG2516_03680: hypothetical protein
 
Loktanella vestfoldensis SKA53
 2
Oceanicola batsensis HTCC2597

Gene: OB2597_03569: hypothetical protein

Gene: OB2597_05505: hypothetical protein
 
Roseovarius nubinhibens ISM

Gene: ISM_15980: hypothetical protein
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040

Gene: TM1040_0261: hypothetical protein
 
Silicibacter pomeroyi DSS-3

Gene: SPO2022: hypothetical protein
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
hypothetical protein
sufC
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_0437: Iron-sulfur cluster assembly ATPase protein SufC
 
Paracoccus denitrificans PD1222

Gene: Pden_3966: Iron-sulfur cluster assembly ATPase protein SufC
 
Jannaschia sp. CCS1

Gene: Jann_2359: Iron-sulfur cluster assembly ATPase protein SufC
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_03994: Iron-sulfur cluster assembly ATPase protein SufC
 
Oceanicola granulosus HTCC2516

Gene: OG2516_03675: Iron-sulfur cluster assembly ATPase protein SufC
 
Loktanella vestfoldensis SKA53

Gene: SKA53_05168: Iron-sulfur cluster assembly ATPase protein SufC
 
Oceanicola batsensis HTCC2597

Gene: OB2597_03564: Iron-sulfur cluster assembly ATPase protein SufC
 
Roseovarius nubinhibens ISM

Gene: ISM_15975: Iron-sulfur cluster assembly ATPase protein SufC
 
Roseovarius sp. 217

Gene: ROS217_20517: Iron-sulfur cluster assembly ATPase protein SufC
 
Sulfitobacter sp. EE-36

Gene: EE36_14327: Iron-sulfur cluster assembly ATPase protein SufC
 
Silicibacter TM1040

Gene: TM1040_1245: Iron-sulfur cluster assembly ATPase protein SufC
 
Silicibacter pomeroyi DSS-3

Gene: SPO2018: Iron-sulfur cluster assembly ATPase protein SufC
 
Roseobacter sp. MED193

Gene: MED193_04291: Iron-sulfur cluster assembly ATPase protein SufC
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_2616: Iron-sulfur cluster assembly ATPase protein SufC
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_03226: Iron-sulfur cluster assembly ATPase protein SufC
Iron-sulfur cluster assembly ATPase protein SufC
sufD
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_3967: Iron-sulfur cluster assembly protein SufD
 
Jannaschia sp. CCS1

Gene: Jann_2358: Iron-sulfur cluster assembly protein SufD
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_03989: Iron-sulfur cluster assembly protein SufD
 
Oceanicola granulosus HTCC2516

Gene: OG2516_03670: Iron-sulfur cluster assembly protein SufD
 
Loktanella vestfoldensis SKA53

Gene: SKA53_05163: Iron-sulfur cluster assembly protein SufD
 
Oceanicola batsensis HTCC2597

Gene: OB2597_03559: Iron-sulfur cluster assembly protein SufD
 
Roseovarius nubinhibens ISM

Gene: ISM_15970: Iron-sulfur cluster assembly protein SufD
 
Roseovarius sp. 217

Gene: ROS217_20512: Iron-sulfur cluster assembly protein SufD
 
Sulfitobacter sp. EE-36

Gene: EE36_14332: Iron-sulfur cluster assembly protein SufD
 
Silicibacter TM1040

Gene: TM1040_1246: Iron-sulfur cluster assembly protein SufD
 
Silicibacter pomeroyi DSS-3

Gene: SPO2017: Iron-sulfur cluster assembly protein SufD
 
Roseobacter sp. MED193

Gene: MED193_04286: Iron-sulfur cluster assembly protein SufD
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_2615: Iron-sulfur cluster assembly protein SufD
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_03221: Iron-sulfur cluster assembly protein SufD
Iron-sulfur cluster assembly protein SufD
PF04893
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_0433: hypothetical protein
 
Paracoccus denitrificans PD1222

Gene: Pden_3968: hypothetical protein
 
Jannaschia sp. CCS1

Gene: Jann_2357: hypothetical protein
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_03984: hypothetical protein
 
Oceanicola granulosus HTCC2516

Gene: OG2516_03665: hypothetical protein
 
Loktanella vestfoldensis SKA53

Gene: SKA53_05158: hypothetical protein
 
Oceanicola batsensis HTCC2597

Gene: OB2597_03554: hypothetical protein
 
Roseovarius nubinhibens ISM

Gene: ISM_15965: hypothetical protein
 
Roseovarius sp. 217

Gene: ROS217_20507: hypothetical protein
 
Sulfitobacter sp. EE-36

Gene: EE36_14337: hypothetical protein
 
Silicibacter TM1040

Gene: TM1040_1247: hypothetical protein
 
Silicibacter pomeroyi DSS-3

Gene: SPO2016: hypothetical protein
 
Roseobacter sp. MED193

Gene: MED193_04281: hypothetical protein
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
hypothetical protein
PF04893
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_0432: hypothetical protein
 
Paracoccus denitrificans PD1222

Gene: Pden_3969: hypothetical protein
 
Jannaschia sp. CCS1

Gene: Jann_2356: hypothetical protein
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_03979: hypothetical protein
 
Oceanicola granulosus HTCC2516

Gene: OG2516_03660: hypothetical protein
 
Loktanella vestfoldensis SKA53

Gene: SKA53_05153: hypothetical protein
 
Oceanicola batsensis HTCC2597

Gene: OB2597_03549: hypothetical protein
 
Roseovarius nubinhibens ISM

Gene: ISM_15960: hypothetical protein
 
Roseovarius sp. 217

Gene: ROS217_20502: hypothetical protein
 
Sulfitobacter sp. EE-36

Gene: EE36_14342: hypothetical protein
 
Silicibacter TM1040

Gene: TM1040_1248: hypothetical protein
 
Silicibacter pomeroyi DSS-3

Gene: SPO2015: hypothetical protein
 
Roseobacter sp. MED193

Gene: MED193_04276: hypothetical protein
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
hypothetical protein
sufS2
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_0431: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Paracoccus denitrificans PD1222

Gene: Pden_3970: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Jannaschia sp. CCS1

Gene: Jann_2355: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_03974: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Oceanicola granulosus HTCC2516

Gene: OG2516_03655: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Loktanella vestfoldensis SKA53

Gene: SKA53_05148: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Oceanicola batsensis HTCC2597

Gene: OB2597_03544: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Roseovarius nubinhibens ISM

Gene: ISM_15955: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Roseovarius sp. 217

Gene: ROS217_20497: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Sulfitobacter sp. EE-36

Gene: EE36_14347: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Silicibacter TM1040

Gene: TM1040_1249: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Silicibacter pomeroyi DSS-3

Gene: SPO2014: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Roseobacter sp. MED193

Gene: MED193_04271: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_2614: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_03216: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
TIGR01444
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1

Gene: Jann_2363: Methyltransferase FkbM
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3

Gene: SPO2020: Methyltransferase FkbM
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Methyltransferase FkbM
PF04230
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1

Gene: Jann_2361: ExoV domain protein
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36

Gene: EE36_14322: ExoV domain protein
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193

Gene: MED193_04296: ExoV domain protein
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
ExoV domain protein
MED193_04306
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193

Gene: MED193_04306: hypothetical protein
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
hypothetical protein
PF01906
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_0439: hypothetical protein
 
Paracoccus denitrificans PD1222

Gene: Pden_3965: hypothetical protein
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597

Gene: OB2597_03574: hypothetical protein
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217

Gene: ROS217_20527: hypothetical protein
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040

Gene: TM1040_1243: hypothetical protein
 
Silicibacter pomeroyi DSS-3

Gene: SPO2021: hypothetical protein
 
Roseobacter sp. MED193

Gene: MED193_04301: hypothetical protein
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_00480: hypothetical protein
hypothetical protein
EE36_14317
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36

Gene: EE36_14317: hypothetical protein
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
hypothetical protein
OG2516_18780
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516

Gene: OG2516_18780: probable glycosyl transferase
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM

Gene: ISM_03545: Probable glycosyl transferase
 
Roseovarius sp. 217

Gene: ROS217_20522: hypothetical protein
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
probable glycosyl transferase
 
CRON 2.
fssA
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_2214: putative nifU-like iron-sulphur cluster scaffold protein
 
Paracoccus denitrificans PD1222

Gene: Pden_0531: putative nifU-like iron-sulphur cluster scaffold protein
*
Jannaschia sp. CCS1

Site:
position = -79
score = 4.85083
sequence = ACTTTAGAACGATTCCAGTTC

Gene: Jann_0865: putative nifU-like iron-sulphur cluster scaffold protein
*
Rhodobacterales bacterium HTCC2654

Site:
position = -52
score = 4.80568
sequence = GACTTGGAACGATTCCAAGCT

Gene: RB2654_18613: putative nifU-like iron-sulphur cluster scaffold protein
 
Oceanicola granulosus HTCC2516

Gene: OG2516_07967: putative nifU-like iron-sulphur cluster scaffold protein
*
Loktanella vestfoldensis SKA53

Site:
position = -78
score = 5.93031
sequence = AGTTTAGAATCGTTCCAAATC

Gene: SKA53_14701: putative nifU-like iron-sulphur cluster scaffold protein
*
Oceanicola batsensis HTCC2597

Site:
position = -79
score = 5.2442
sequence = GAATTAGAACGGTTCTAAATC

Gene: OB2597_10089: putative nifU-like iron-sulphur cluster scaffold protein
*
Roseovarius nubinhibens ISM

Site:
position = -77
score = 5.55473
sequence = TTTTTAGAATCGTTCCAAATC

Gene: ISM_02850: putative nifU-like iron-sulphur cluster scaffold protein
*
Roseovarius sp. 217

Site:
position = -76
score = 5.81444
sequence = ATCTTAGAATGGTTCTAAACC

Gene: ROS217_10487: putative nifU-like iron-sulphur cluster scaffold protein
*
Sulfitobacter sp. EE-36

Site:
position = -76
score = 5.52203
sequence = AACTTAGAATCGTTCCAAACC

Gene: EE36_09510: putative nifU-like iron-sulphur cluster scaffold protein
*
Silicibacter TM1040

Site:
position = -74
score = 5.74923
sequence = AATTTAGAACCATTCCAAAAC

Gene: TM1040_3091: putative nifU-like iron-sulphur cluster scaffold protein
*
Silicibacter pomeroyi DSS-3

Site:
position = -76
score = 5.71341
sequence = TCTTTAGAACCGTTCCAAAGT

Gene: SPO0382: putative nifU-like iron-sulphur cluster scaffold protein
*
Roseobacter sp. MED193

Site:
position = -75
score = 6.40217
sequence = AATTTAGAATAATTCTAAACC

Gene: MED193_10358: putative nifU-like iron-sulphur cluster scaffold protein
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_0522: putative nifU-like iron-sulphur cluster scaffold protein
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_10184: putative nifU-like iron-sulphur cluster scaffold protein
putative nifU-like iron-sulphur cluster scaffold protein
 
CRON 3.
mbfA
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -29
score = 5.85157
sequence = AATTTAGAATGACTCTAAAAA

Gene: RSP_0850: membrane-bound ferritin
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
*
Rhodobacterales bacterium HTCC2654

Site:
position = -30
score = 5.96709
sequence = AGTTTGGAATCGTTCCAAACA

Gene: RB2654_16991: membrane-bound ferritin
 
Oceanicola granulosus HTCC2516
*
Loktanella vestfoldensis SKA53

Site:
position = -32
score = 6.12841
sequence = AGATTAGAATCATTCTAAATA

Gene: SKA53_14166: membrane-bound ferritin
 
Oceanicola batsensis HTCC2597
*
Roseovarius nubinhibens ISM

Site:
position = -39
score = 5.90265
sequence = AGTTTAGAATCATTCTAATTG

Gene: ISM_08740: membrane-bound ferritin
*
Roseovarius sp. 217

Site:
position = -30
score = 6.34018
sequence = AGTTTAGAATTATTCTAAAAG

Gene: ROS217_11126: membrane-bound ferritin
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
*
Silicibacter pomeroyi DSS-3

Site:
position = -32
score = 5.79759
sequence = ATCTTGGAATCATTCTAAATT

Gene: SPO3842: membrane-bound ferritin
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
membrane-bound ferritin
 
CRON 4.
ccpA
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -87
score = 4.89959
sequence = AGATTAGAATTGATCTAAGTC

Gene: RSP_2395: Cytochrome c551 peroxidase (EC 1.11.1.5)
 
Paracoccus denitrificans PD1222

Gene: Pden_0893: Cytochrome c551 peroxidase (EC 1.11.1.5)
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
*
Roseovarius sp. 217

Site:
position = -75
score = 5.51004
sequence = GATTTAGAATGGTTCCAAACG

Gene: ROS217_11501: Cytochrome c551 peroxidase (EC 1.11.1.5)
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
*
Silicibacter pomeroyi DSS-3

Site:
position = -72
score = 5.26077
sequence = ATGTTAGAATGATTCTAATCG

Gene: SPO0330: Cytochrome c551 peroxidase (EC 1.11.1.5)
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Cytochrome c551 peroxidase (EC 1.11.1.5)
 
CRON 5.
irpA
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_1548: Iron-regulated protein A precursor
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1

Gene: Jann_1368: Iron-regulated protein A precursor
*
Rhodobacterales bacterium HTCC2654

Site:
position = -46
score = 5.42956
sequence = TGATTGGAACCATTCCAAATT

Gene: RB2654_13154: Iron-regulated protein A precursor
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM

Gene: ISM_04365: Iron-regulated protein A precursor
 
Roseovarius sp. 217

Gene: ROS217_10107: Iron-regulated protein A precursor
 
Sulfitobacter sp. EE-36

Gene: EE36_02713: Iron-regulated protein A precursor
 
Silicibacter TM1040

Gene: TM1040_2199: Iron-regulated protein A precursor
 
Silicibacter pomeroyi DSS-3

Gene: SPO0086: Iron-regulated protein A precursor
 
Roseobacter sp. MED193

Gene: MED193_19664: Iron-regulated protein A precursor
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Iron-regulated protein A precursor
bfd
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_1547: Bacterioferritin-associated ferredoxin
 
Paracoccus denitrificans PD1222

Gene: Pden_0615: Bacterioferritin-associated ferredoxin
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_13144: Bacterioferritin-associated ferredoxin
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597

Gene: OB2597_06820: Bacterioferritin-associated ferredoxin
 
Roseovarius nubinhibens ISM

Gene: ISM_00995: Bacterioferritin-associated ferredoxin
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040

Gene: TM1040_2200: Bacterioferritin-associated ferredoxin
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193

Gene: MED193_19654: Bacterioferritin-associated ferredoxin
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_3075: Bacterioferritin-associated ferredoxin
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_12430: Bacterioferritin-associated ferredoxin
Bacterioferritin-associated ferredoxin
bfr
 2
Rhodobacter sphaeroides 2.4.1

Gene: RSP_3342: Bacterioferritin (cytochrome b1)

Gene: RSP_1546: Bacterioferritin (cytochrome b1)
 
Paracoccus denitrificans PD1222

Gene: Pden_0616: Bacterioferritin (cytochrome b1)
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_13139: Bacterioferritin (cytochrome b1)
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
*
Oceanicola batsensis HTCC2597

Site:
position = -85
score = 6.09245
sequence = TTTTTGGAATAATTCTAAATT

Gene: OB2597_06815: Bacterioferritin (cytochrome b1)
 
Roseovarius nubinhibens ISM

Gene: ISM_00990: Bacterioferritin (cytochrome b1)
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040

Gene: TM1040_2201: Bacterioferritin (cytochrome b1)
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193

Gene: MED193_19649: Bacterioferritin (cytochrome b1)
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_3076: Bacterioferritin (cytochrome b1)
 
Oceanicaulis alexandrii HTCC2633
Bacterioferritin (cytochrome b1)
 
CRON 6.
katG
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1

Gene: Jann_1586: Catalase (EC 1.11.1.6) / Peroxidase (EC 1.11.1.7)
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
*
Loktanella vestfoldensis SKA53

Site:
position = -85
score = 4.87829
sequence = ATGTTAGAAGGATTCTAAGCG

Gene: SKA53_14466: Catalase (EC 1.11.1.6) / Peroxidase (EC 1.11.1.7)
 
Oceanicola batsensis HTCC2597
*
Roseovarius nubinhibens ISM

Site:
position = -92
score = 4.61939
sequence = CGCTTAGAACGATTCCAAGGC

Gene: ISM_16225: Catalase (EC 1.11.1.6) / Peroxidase (EC 1.11.1.7)
 
Roseovarius sp. 217
*
Sulfitobacter sp. EE-36

Site:
position = -111
score = 4.47972
sequence = ctgTTAGAAcAATTCcAgAaa

Gene: EE36_11399: Catalase (EC 1.11.1.6) / Peroxidase (EC 1.11.1.7)
*
Silicibacter TM1040

Site:
position = -146
score = 5.71905
sequence = AACTTAGAATAATTCTGAACT

Gene: TM1040_2791: Catalase (EC 1.11.1.6) / Peroxidase (EC 1.11.1.7)
 
Silicibacter pomeroyi DSS-3

Gene: SPOA0061: Catalase (EC 1.11.1.6) / Peroxidase (EC 1.11.1.7)
 
Roseobacter sp. MED193

Gene: MED193_12153: Catalase (EC 1.11.1.6) / Peroxidase (EC 1.11.1.7)
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Catalase (EC 1.11.1.6) / Peroxidase (EC 1.11.1.7)
 
CRON 7.
dps
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
*
Jannaschia sp. CCS1

Site:
position = -123
score = 6.27915
sequence = AGTTTAGAATTATTCTAGACA

Gene: Jann_3276: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53

Gene: SKA53_06272: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
*
Sulfitobacter sp. EE-36

Site:
position = -116
score = 6.25788
sequence = AGTTTAGAATAATTCCAAAAA

Gene: EE36_01790: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD