Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Irr - Rhizobiales

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Heme
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 122 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Sinorhizobium meliloti 1021 20 10
Rhizobium sp. NGR234 21 11
Rhizobium leguminosarum bv. viciae 3841 25 9
Rhizobium etli CFN 42 14 7
Agrobacterium tumefaciens str. C58 (Cereon) 27 12
Mesorhizobium sp. BNC1 11 4
Mesorhizobium loti MAFF303099 20 8
Brucella melitensis 16M 12 4
Bartonella quintana str. Toulouse 11 3
Rhodopseudomonas palustris CGA009 20 9
Bradyrhizobium japonicum USDA 110 20 11
Bradyrhizobium sp. BTAi1 11 5
Nitrobacter winogradskyi Nb-255 3 3
Azorhizobium caulinodans ORS 571 25 9
Xanthobacter autotrophicus Py2 19 9
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
hmuP
 
Sinorhizobium meliloti 1021

Gene: SMc01747: HmuP hemin uptake protein
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL3696: HmuP hemin uptake protein
 
Rhizobium etli CFN 42

Gene: RHE_CH03267: HmuP hemin uptake protein
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1

Gene: Meso_1441: HmuP hemin uptake protein
 
Mesorhizobium loti MAFF303099

Gene: msl1154: HmuP hemin uptake protein
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
*
Rhodopseudomonas palustris CGA009

Site:
position = -87
score = 3.80484
sequence = CGTTTATAGTAATTATAAGAC

Gene: RPA2121: HmuP hemin uptake protein
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
HmuP hemin uptake protein
hmuT
 
Sinorhizobium meliloti 1021

Gene: SMc01512: Hemin ABC transporter, hemin-binding protein
 
Rhizobium sp. NGR234

Gene: NGR_c24580: Hemin ABC transporter, hemin-binding protein
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL3698: Hemin ABC transporter, hemin-binding protein
 
Rhizobium etli CFN 42

Gene: RHE_CH03269: Hemin ABC transporter, hemin-binding protein
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2460: Hemin ABC transporter, hemin-binding protein
 
Mesorhizobium sp. BNC1

Gene: Meso_1442: Hemin ABC transporter, hemin-binding protein
 
Mesorhizobium loti MAFF303099

Gene: mll1151: Hemin ABC transporter, hemin-binding protein
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse

Gene: BQ04140: Hemin ABC transporter, hemin-binding protein
 
Rhodopseudomonas palustris CGA009

Gene: RPA2120: Hemin ABC transporter, hemin-binding protein
*
Bradyrhizobium japonicum USDA 110

Site:
position = -302
score = 4.68756
sequence = AGTTTATATCGATTGTAAATT

Gene: blr7077: Hemin ABC transporter, hemin-binding protein
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_2324: Hemin ABC transporter, hemin-binding protein
*
Azorhizobium caulinodans ORS 571

Site:
position = -65
score = 3.71479
sequence = CAAGTTGATTACCTCTAAACT

Gene: AZC_4385: Hemin ABC transporter, hemin-binding protein
*
Xanthobacter autotrophicus Py2

Site:
position = -56
score = 4.5983
sequence = AACTTTGAAAAAATCAAAACT

Gene: Xaut_4192: Hemin ABC transporter, hemin-binding protein
Hemin ABC transporter, hemin-binding protein
hmuU
 
Sinorhizobium meliloti 1021

Gene: SMc01511: Hemin ABC transporter, permease protein
 
Rhizobium sp. NGR234

Gene: NGR_c24590: Hemin ABC transporter, permease protein
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL3699: Hemin ABC transporter, permease protein
 
Rhizobium etli CFN 42

Gene: RHE_CH03270: Hemin ABC transporter, permease protein
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2459: Hemin ABC transporter, permease protein
 
Mesorhizobium sp. BNC1

Gene: Meso_1443: Hemin ABC transporter, permease protein
 
Mesorhizobium loti MAFF303099

Gene: mll1150: Hemin ABC transporter, permease protein
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse

Gene: BQ04130: Hemin ABC transporter, permease protein
 
Rhodopseudomonas palustris CGA009

Gene: RPA2119: Hemin ABC transporter, permease protein
 
Bradyrhizobium japonicum USDA 110

Gene: blr7078: Hemin ABC transporter, permease protein
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_2323: Hemin ABC transporter, permease protein
 
Azorhizobium caulinodans ORS 571

Gene: AZC_4386: Hemin ABC transporter, permease protein
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4193: Hemin ABC transporter, permease protein
Hemin ABC transporter, permease protein
hmuV
 
Sinorhizobium meliloti 1021

Gene: SMc01510: Hemin ABC transporter, ATPase component
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL3700: Hemin ABC transporter, ATPase component
 
Rhizobium etli CFN 42

Gene: RHE_CH03271: Hemin ABC transporter, ATPase component
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2458: Hemin ABC transporter, ATPase component
 
Mesorhizobium sp. BNC1

Gene: Meso_1444: Hemin ABC transporter, ATPase component
 
Mesorhizobium loti MAFF303099

Gene: mll1149: Hemin ABC transporter, ATPase component
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse

Gene: BQ04120: Hemin ABC transporter, ATPase component
 
Rhodopseudomonas palustris CGA009

Gene: RPA2118: Hemin ABC transporter, ATPase component
 
Bradyrhizobium japonicum USDA 110

Gene: blr7079: Hemin ABC transporter, ATPase component
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_2322: Hemin ABC transporter, ATPase component
 
Azorhizobium caulinodans ORS 571

Gene: AZC_4387: Hemin ABC transporter, ATPase component
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4194: Hemin ABC transporter, ATPase component
Hemin ABC transporter, ATPase component
 
CRON 2.
fssA
*
Sinorhizobium meliloti 1021

Site:
position = -60
score = 5.99408
sequence = ATTTTGGAACAATTCTAAAAA

Gene: SMc01119: putative nifU-like iron-sulphur cluster scaffold protein
*
Rhizobium sp. NGR234

Site:
position = -59
score = 6.04353
sequence = ATTTTTGAATTATTCTAAAGA

Gene: NGR_c00370: putative nifU-like iron-sulphur cluster scaffold protein
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -57
score = 5.36321
sequence = TCTTTTGAAGCATTCTAAAGA

Gene: RL0400: putative nifU-like iron-sulphur cluster scaffold protein
*
Rhizobium etli CFN 42

Site:
position = -57
score = 5.44429
sequence = TCTTTTGAAGAATTCTAAAGA

Gene: RHE_CH00381: putative nifU-like iron-sulphur cluster scaffold protein
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -56
score = 5.74615
sequence = TTTTTGGAAGAATTCTAAATT

Gene: Atu0351: putative nifU-like iron-sulphur cluster scaffold protein
*
Mesorhizobium sp. BNC1

Site:
position = -44
score = 5.99408
sequence = ATTTTAGAATTGTTCCAAAAA

Gene: Meso_4037: putative nifU-like iron-sulphur cluster scaffold protein
*
Mesorhizobium loti MAFF303099

Site:
position = -50
score = 6.19081
sequence = TATTTAGAACTATTCCAAACT

Gene: mll5315: putative nifU-like iron-sulphur cluster scaffold protein
 
Brucella melitensis 16M

Gene: BMEI1808: putative nifU-like iron-sulphur cluster scaffold protein
 
Bartonella quintana str. Toulouse

Gene: BQ10720: putative nifU-like iron-sulphur cluster scaffold protein
 
Rhodopseudomonas palustris CGA009

Gene: RPA0453: putative nifU-like iron-sulphur cluster scaffold protein
 
Bradyrhizobium japonicum USDA 110

Gene: bll0800: putative nifU-like iron-sulphur cluster scaffold protein
 
Bradyrhizobium sp. BTAi1

Gene: BBta_0040: putative nifU-like iron-sulphur cluster scaffold protein
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_0009: putative nifU-like iron-sulphur cluster scaffold protein
 
Azorhizobium caulinodans ORS 571

Gene: AZC_4703: putative nifU-like iron-sulphur cluster scaffold protein
 
Xanthobacter autotrophicus Py2

Gene: Xaut_1823: putative nifU-like iron-sulphur cluster scaffold protein
putative nifU-like iron-sulphur cluster scaffold protein
 
CRON 3.
fhuA
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -168
score = 5.57018
sequence = AGATTTGAATAATTCCAAGCT

Gene: Atu4022: Ferric hydroxamate outer membrane receptor FhuA
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
*
Rhodopseudomonas palustris CGA009

Site:
position = -223
score = 5.46425
sequence = TGATTTGAACGATTCAAAAAT

Gene: RPA1876: Ferric hydroxamate outer membrane receptor FhuA
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
*
Azorhizobium caulinodans ORS 571

Site:
position = -53
score = 5.29146
sequence = AGATTTGAATACTTCTGAACT

Gene: AZC_1626: Ferric hydroxamate outer membrane receptor FhuA
 
Xanthobacter autotrophicus Py2
Ferric hydroxamate outer membrane receptor FhuA
fhuC
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42

Gene: RHE_PE00282: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), ATP-binding protein FhuC
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4025: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), ATP-binding protein FhuC
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1625: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), ATP-binding protein FhuC
 
Xanthobacter autotrophicus Py2
Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), ATP-binding protein FhuC
fhuD
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4023: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), periplasmic substrate binding protein FhuD
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1624: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), periplasmic substrate binding protein FhuD
 
Xanthobacter autotrophicus Py2
Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), periplasmic substrate binding protein FhuD
fhuB
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4024: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), permease component FhuB
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1623: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), permease component FhuB
 
Xanthobacter autotrophicus Py2
Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), permease component FhuB
PF08021
 
Sinorhizobium meliloti 1021

Gene: SMa1740: iron-chelator utilization protein
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2454: iron-chelator utilization protein
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1622: iron-chelator utilization protein
 
Xanthobacter autotrophicus Py2
iron-chelator utilization protein
PF03929
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA1875: putative iron-regulated membrane protein
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1

Gene: BBta_2666: putative iron-regulated membrane protein
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
putative iron-regulated membrane protein
 
CRON 4.
fatB
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -130
score = 5.32581
sequence = AATTCAGAACCGTTCTAAAAC

Gene: Atu2473: iron siderophore ABC transporter, periplasmic protein
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M

Gene: BMEII0607: iron siderophore ABC transporter, periplasmic protein
 
Bartonella quintana str. Toulouse

Gene: BQ10300: iron siderophore ABC transporter, periplasmic protein
 
Rhodopseudomonas palustris CGA009

Gene: RPA2385: iron siderophore ABC transporter, periplasmic protein
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
iron siderophore ABC transporter, periplasmic protein
fatD
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2474: iron siderophore ABC transporter, permease protein
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M

Gene: BMEII0606: iron siderophore ABC transporter, permease protein
 
Bartonella quintana str. Toulouse

Gene: BQ10310: iron siderophore ABC transporter, permease protein
 
Rhodopseudomonas palustris CGA009

Gene: RPA2384: iron siderophore ABC transporter, permease protein
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
iron siderophore ABC transporter, permease protein
fatC
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2475: iron siderophore ABC transporter, permease protein
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M

Gene: BMEII0605: iron siderophore ABC transporter, permease protein
 
Bartonella quintana str. Toulouse

Gene: BQ10320: iron siderophore ABC transporter, permease protein
 
Rhodopseudomonas palustris CGA009

Gene: RPA2383: iron siderophore ABC transporter, permease protein
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
iron siderophore ABC transporter, permease protein
fatE
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2476: iron siderophore ABC transporter, ATPase protein
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M

Gene: BMEII0604: iron siderophore ABC transporter, ATPase protein
 
Bartonella quintana str. Toulouse

Gene: BQ10330: iron siderophore ABC transporter, ATPase protein
 
Rhodopseudomonas palustris CGA009

Gene: RPA2382: iron siderophore ABC transporter, ATPase protein
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
iron siderophore ABC transporter, ATPase protein
 
CRON 5.
sufS2
*
Sinorhizobium meliloti 1021

Site:
position = -133
score = 6.17259
sequence = ACTTTAGAACCGTTCAAAACT

Gene: SMc00529: Cysteine desulfurase (EC 2.8.1.7)
*
Rhizobium sp. NGR234

Site:
position = -140
score = 6.17259
sequence = ACTTTAGAACCGTTCAAAACT

Gene: NGR_c15400: Cysteine desulfurase (EC 2.8.1.7)
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -134
score = 6.55074
sequence = AGTTTAGAACAATTCGAAACT

Gene: RL2583: Cysteine desulfurase (EC 2.8.1.7)
*
Rhizobium etli CFN 42

Site:
position = -206
score = 6.55074
sequence = AGTTTAGAACAATTCGAAACT

Gene: RHE_CH02254: Cysteine desulfurase (EC 2.8.1.7)
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -125
score = 6.63346
sequence = AGTTTAGAATAATTCGAAACT

Gene: Atu1825: Cysteine desulfurase (EC 2.8.1.7)
*
Mesorhizobium sp. BNC1

Site:
position = -131
score = 6.49319
sequence = AGTTTAGAACTGTTCAAAACT

Gene: Meso_1782: Cysteine desulfurase (EC 2.8.1.7)
*
Mesorhizobium loti MAFF303099

Site:
position = -150
score = 6.57591
sequence = AGTTTAGAACTATTCAAAACT

Gene: mlr0015: Cysteine desulfurase (EC 2.8.1.7)
 
Brucella melitensis 16M

Gene: BMEI1043: Cysteine desulfurase (EC 2.8.1.7)
 
Bartonella quintana str. Toulouse

Gene: BQ05940: Cysteine desulfurase (EC 2.8.1.7)
 
Rhodopseudomonas palustris CGA009

Gene: RPA2463: Cysteine desulfurase (EC 2.8.1.7)
 
Bradyrhizobium japonicum USDA 110

Gene: blr4338: Cysteine desulfurase (EC 2.8.1.7)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_3965: Cysteine desulfurase (EC 2.8.1.7)
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1665: Cysteine desulfurase (EC 2.8.1.7)
*
Azorhizobium caulinodans ORS 571

Site:
position = -99
score = 5.96998
sequence = TATTTAGAATAATTCTAATGT

Gene: AZC_3616: Cysteine desulfurase (EC 2.8.1.7)
*
Xanthobacter autotrophicus Py2

Site:
position = -158
score = 6.03007
sequence = GATTTAGAATAATTCTAATCT

Gene: Xaut_4470: Cysteine desulfurase (EC 2.8.1.7)
Cysteine desulfurase (EC 2.8.1.7)
sufB
 
Sinorhizobium meliloti 1021

Gene: SMc00530: ABC transporter involved in Fe-S cluster assembly, permease protein
 
Rhizobium sp. NGR234

Gene: NGR_c15410: ABC transporter involved in Fe-S cluster assembly, permease protein
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL2582: ABC transporter involved in Fe-S cluster assembly, permease protein
 
Rhizobium etli CFN 42

Gene: RHE_CH02253: ABC transporter involved in Fe-S cluster assembly, permease protein
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu1824: ABC transporter involved in Fe-S cluster assembly, permease protein
 
Mesorhizobium sp. BNC1

Gene: Meso_1781: ABC transporter involved in Fe-S cluster assembly, permease protein
 
Mesorhizobium loti MAFF303099

Gene: mlr0016: ABC transporter involved in Fe-S cluster assembly, permease protein
*
Brucella melitensis 16M

Site:
position = -119
score = 4.84057
sequence = AGTTTAGAGAGGTTTTAAAGA

Gene: BMEI1042: ABC transporter involved in Fe-S cluster assembly, permease protein
*
Bartonella quintana str. Toulouse

Site:
position = -148
score = 5.18347
sequence = GAATTAGAATTATTTTAAAAA

Gene: BQ05950: ABC transporter involved in Fe-S cluster assembly, permease protein
 
Rhodopseudomonas palustris CGA009

Gene: RPA2464: ABC transporter involved in Fe-S cluster assembly, permease protein
 
Bradyrhizobium japonicum USDA 110

Gene: blr4339: ABC transporter involved in Fe-S cluster assembly, permease protein
 
Bradyrhizobium sp. BTAi1

Gene: BBta_3966: ABC transporter involved in Fe-S cluster assembly, permease protein
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1664: ABC transporter involved in Fe-S cluster assembly, permease protein
 
Azorhizobium caulinodans ORS 571

Gene: AZC_3615: ABC transporter involved in Fe-S cluster assembly, permease protein
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4469: ABC transporter involved in Fe-S cluster assembly, permease protein
ABC transporter involved in Fe-S cluster assembly, permease protein
RL2581
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL2581: hypothetical protein
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
hypothetical protein
sufC
 
Sinorhizobium meliloti 1021

Gene: SMc00531: ABC transporter involved in Fe-S cluster assembly, ATP-binding protein
 
Rhizobium sp. NGR234

Gene: NGR_c15420: ABC transporter involved in Fe-S cluster assembly, ATP-binding protein
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL2580: ABC transporter involved in Fe-S cluster assembly, ATP-binding protein
 
Rhizobium etli CFN 42

Gene: RHE_CH02251: ABC transporter involved in Fe-S cluster assembly, ATP-binding protein
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu1823: ABC transporter involved in Fe-S cluster assembly, ATP-binding protein
 
Mesorhizobium sp. BNC1

Gene: Meso_1780: ABC transporter involved in Fe-S cluster assembly, ATP-binding protein
 
Mesorhizobium loti MAFF303099

Gene: mlr0019: ABC transporter involved in Fe-S cluster assembly, ATP-binding protein
 
Brucella melitensis 16M

Gene: BMEI1041: ABC transporter involved in Fe-S cluster assembly, ATP-binding protein
 
Bartonella quintana str. Toulouse

Gene: BQ05960: ABC transporter involved in Fe-S cluster assembly, ATP-binding protein
 
Rhodopseudomonas palustris CGA009

Gene: RPA2465: ABC transporter involved in Fe-S cluster assembly, ATP-binding protein
 
Bradyrhizobium japonicum USDA 110

Gene: blr4340: ABC transporter involved in Fe-S cluster assembly, ATP-binding protein
 
Bradyrhizobium sp. BTAi1

Gene: BBta_3967: ABC transporter involved in Fe-S cluster assembly, ATP-binding protein
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1663: ABC transporter involved in Fe-S cluster assembly, ATP-binding protein
 
Azorhizobium caulinodans ORS 571

Gene: AZC_3614: ABC transporter involved in Fe-S cluster assembly, ATP-binding protein
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4468: ABC transporter involved in Fe-S cluster assembly, ATP-binding protein
ABC transporter involved in Fe-S cluster assembly, ATP-binding protein
sufD
 
Sinorhizobium meliloti 1021

Gene: SMc00532: ABC transporter involved in Fe-S cluster assembly, permease protein
 
Rhizobium sp. NGR234

Gene: NGR_c15430: ABC transporter involved in Fe-S cluster assembly, permease protein
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL2579: ABC transporter involved in Fe-S cluster assembly, permease protein
 
Rhizobium etli CFN 42

Gene: RHE_CH02250: ABC transporter involved in Fe-S cluster assembly, permease protein
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu1822: ABC transporter involved in Fe-S cluster assembly, permease protein
 
Mesorhizobium sp. BNC1

Gene: Meso_1779: ABC transporter involved in Fe-S cluster assembly, permease protein
 
Mesorhizobium loti MAFF303099

Gene: mlr0020: ABC transporter involved in Fe-S cluster assembly, permease protein
 
Brucella melitensis 16M

Gene: BMEI1040: ABC transporter involved in Fe-S cluster assembly, permease protein
 
Bartonella quintana str. Toulouse

Gene: BQ05970: ABC transporter involved in Fe-S cluster assembly, permease protein
 
Rhodopseudomonas palustris CGA009

Gene: RPA2466: ABC transporter involved in Fe-S cluster assembly, permease protein
 
Bradyrhizobium japonicum USDA 110

Gene: blr4341: ABC transporter involved in Fe-S cluster assembly, permease protein
 
Bradyrhizobium sp. BTAi1

Gene: BBta_3968: ABC transporter involved in Fe-S cluster assembly, permease protein
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1662: ABC transporter involved in Fe-S cluster assembly, permease protein
 
Azorhizobium caulinodans ORS 571

Gene: AZC_3613: ABC transporter involved in Fe-S cluster assembly, permease protein
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4467: ABC transporter involved in Fe-S cluster assembly, permease protein
ABC transporter involved in Fe-S cluster assembly, permease protein
sufS1
 
Sinorhizobium meliloti 1021

Gene: SMc00533: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Rhizobium sp. NGR234

Gene: NGR_c15440: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL2578: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Rhizobium etli CFN 42

Gene: RHE_CH02249: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu1821: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Mesorhizobium sp. BNC1

Gene: Meso_1778: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Mesorhizobium loti MAFF303099

Gene: mlr0021: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Brucella melitensis 16M

Gene: BMEI1039: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Bartonella quintana str. Toulouse

Gene: BQ05980: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Rhodopseudomonas palustris CGA009

Gene: RPA2467: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Bradyrhizobium japonicum USDA 110

Gene: blr4342: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Bradyrhizobium sp. BTAi1

Gene: BBta_3969: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1661: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Azorhizobium caulinodans ORS 571

Gene: AZC_3612: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4466: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
PF01883
 
Sinorhizobium meliloti 1021

Gene: SMc00302: PaaD-like protein (DUF59) involved in Fe-S cluster assembly
 
Rhizobium sp. NGR234

Gene: NGR_c15450: PaaD-like protein (DUF59) involved in Fe-S cluster assembly
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL2577: PaaD-like protein (DUF59) involved in Fe-S cluster assembly
 
Rhizobium etli CFN 42

Gene: RHE_CH02248: PaaD-like protein (DUF59) involved in Fe-S cluster assembly
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu1820: PaaD-like protein (DUF59) involved in Fe-S cluster assembly
 
Mesorhizobium sp. BNC1

Gene: Meso_1777: PaaD-like protein (DUF59) involved in Fe-S cluster assembly
 
Mesorhizobium loti MAFF303099

Gene: mlr0023: PaaD-like protein (DUF59) involved in Fe-S cluster assembly
 
Brucella melitensis 16M

Gene: BMEI1038: PaaD-like protein (DUF59) involved in Fe-S cluster assembly
 
Bartonella quintana str. Toulouse

Gene: BQ05990: PaaD-like protein (DUF59) involved in Fe-S cluster assembly
 
Rhodopseudomonas palustris CGA009

Gene: RPA2468: PaaD-like protein (DUF59) involved in Fe-S cluster assembly
 
Bradyrhizobium japonicum USDA 110

Gene: blr4343: PaaD-like protein (DUF59) involved in Fe-S cluster assembly
 
Bradyrhizobium sp. BTAi1

Gene: BBta_3970: PaaD-like protein (DUF59) involved in Fe-S cluster assembly
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1660: PaaD-like protein (DUF59) involved in Fe-S cluster assembly
 
Azorhizobium caulinodans ORS 571

Gene: AZC_3611: PaaD-like protein (DUF59) involved in Fe-S cluster assembly
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4465: PaaD-like protein (DUF59) involved in Fe-S cluster assembly
PaaD-like protein (DUF59) involved in Fe-S cluster assembly
sufA
 
Sinorhizobium meliloti 1021

Gene: SMc00301: Iron binding protein SufA for iron-sulfur cluster assembly
 
Rhizobium sp. NGR234

Gene: NGR_c15460: Iron binding protein SufA for iron-sulfur cluster assembly
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL2576: Iron binding protein SufA for iron-sulfur cluster assembly
 
Rhizobium etli CFN 42

Gene: RHE_CH02247: Iron binding protein SufA for iron-sulfur cluster assembly
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu1819: Iron binding protein SufA for iron-sulfur cluster assembly
 
Mesorhizobium sp. BNC1

Gene: Meso_1776: Iron binding protein SufA for iron-sulfur cluster assembly
 
Mesorhizobium loti MAFF303099

Gene: mlr0024: Iron binding protein SufA for iron-sulfur cluster assembly
 
Brucella melitensis 16M

Gene: BMEI1034: Iron binding protein SufA for iron-sulfur cluster assembly
 
Bartonella quintana str. Toulouse

Gene: BQ05250: Iron binding protein SufA for iron-sulfur cluster assembly
 
Rhodopseudomonas palustris CGA009

Gene: RPA2470: Iron binding protein SufA for iron-sulfur cluster assembly
 
Bradyrhizobium japonicum USDA 110

Gene: blr4344: Iron binding protein SufA for iron-sulfur cluster assembly
 
Bradyrhizobium sp. BTAi1

Gene: BBta_3971: Iron binding protein SufA for iron-sulfur cluster assembly
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1659: Iron binding protein SufA for iron-sulfur cluster assembly
 
Azorhizobium caulinodans ORS 571

Gene: AZC_3609: Iron binding protein SufA for iron-sulfur cluster assembly
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4614: Iron binding protein SufA for iron-sulfur cluster assembly
Iron binding protein SufA for iron-sulfur cluster assembly
PF01541
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42

Gene: RHE_CH02252: Excinuclease ABC, C subunit-like
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Excinuclease ABC, C subunit-like
PF00903
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA2469: putative lactoylglutathione lyase
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_3610: putative lactoylglutathione lyase
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4464: putative lactoylglutathione lyase
putative lactoylglutathione lyase
mlr0017
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099

Gene: mlr0017: unknown protein
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
unknown protein
 
CRON 6.
mbfA
*
Sinorhizobium meliloti 1021

Site:
position = -31
score = 5.77548
sequence = TAATTAGAATTATTCTAAAGA

Gene: SMc00359: membrane-bound ferritin
*
Rhizobium sp. NGR234

Site:
position = -32
score = 6.07349
sequence = TCTTTAGAATTATTCTAAAGA

Gene: NGR_c36170: membrane-bound ferritin
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -34
score = 6.22109
sequence = GATTTAGAATTATTCTAAAAT

Gene: RL0263: membrane-bound ferritin
*
Rhizobium etli CFN 42

Site:
position = -34
score = 6.40217
sequence = GGTTTAGAATTATTCTAAATT

Gene: RHE_CH00257: membrane-bound ferritin
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -32
score = 6.20601
sequence = TATTTAGAATTATTCTAAAAA

Site:
position = -79
score = 5.38471
sequence = TTGTTAGAATTATTCTAAAAC

Gene: Atu0251: membrane-bound ferritin
*
Mesorhizobium sp. BNC1

Site:
position = -37
score = 6.37492
sequence = AGTTTAGAATTATTCTAATCA

Gene: Meso_4072: membrane-bound ferritin
*
Mesorhizobium loti MAFF303099

Site:
position = -35
score = 6.8588
sequence = AGTTTAGAACAATTCTAAACT

Gene: mlr4601: membrane-bound ferritin
*
Brucella melitensis 16M

Site:
position = -203
score = 6.59502
sequence = ATTTTAGAATTATTCTAAATT

Gene: BMEI0354: membrane-bound ferritin
*
Bartonella quintana str. Toulouse

Site:
position = -36
score = 6.11265
sequence = ATCTTAGAATTATTCTAAAGT

Gene: BQ11660: membrane-bound ferritin
*
Rhodopseudomonas palustris CGA009

Site:
position = -34
score = 6.0715
sequence = TATTTAGAAGCGTTCTAAACT

Gene: RPA4303: membrane-bound ferritin
*
Bradyrhizobium japonicum USDA 110

Site:
position = -38
score = 6.69502
sequence = AATTTAGAATCATTCTAAACT

Gene: blr7895: membrane-bound ferritin
*
Bradyrhizobium sp. BTAi1

Site:
position = -58
score = 5.99741
sequence = ACTTTAGAAGCGTTCTAAACA

Gene: BBta_7128: membrane-bound ferritin
 
Nitrobacter winogradskyi Nb-255
*
Azorhizobium caulinodans ORS 571

Site:
position = -36
score = 5.5994
sequence = AAATTAGAAGAGTTCTAAAAA

Gene: AZC_4085: membrane-bound ferritin
*
Xanthobacter autotrophicus Py2

Site:
position = -34
score = 5.28657
sequence = ATATTAGAAATATTCTAATTT

Gene: Xaut_2011: membrane-bound ferritin
membrane-bound ferritin
 
CRON 7.
hmuR
 
Sinorhizobium meliloti 1021

Gene: SMc04205: TonB-dependent haem/haemoglobin receptor
*
Rhizobium sp. NGR234

Site:
position = -73
score = 4.03269
sequence = TGTTTCAAATTGTGCTGAAAC

Gene: NGR_c23520: TonB-dependent haem/haemoglobin receptor
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu3385: TonB-dependent haem/haemoglobin receptor
 
Mesorhizobium sp. BNC1

Gene: Meso_1440: TonB-dependent haem/haemoglobin receptor
 
Mesorhizobium loti MAFF303099

Gene: mlr1155: TonB-dependent haem/haemoglobin receptor
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
*
Rhodopseudomonas palustris CGA009

Site:
position = -162
score = 3.91903
sequence = AAGTTATAATTGCTTTAATCA

Gene: RPA2124: TonB-dependent haem/haemoglobin receptor
*
Bradyrhizobium japonicum USDA 110

Site:
position = -167
score = 4.68756
sequence = AATTTACAATCGATATAAACT

Gene: bll7076: TonB-dependent haem/haemoglobin receptor
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
*2
Azorhizobium caulinodans ORS 571

Site:
position = -82
score = 3.91496
sequence = ACACTGAAACAGTTATAAATA

Gene: AZC_1632: TonB-dependent haem/haemoglobin receptor

Gene: AZC_4384: TonB-dependent haem/haemoglobin receptor
*
Xanthobacter autotrophicus Py2

Site:
position = -221
score = 4.5983
sequence = AGTTTTGATTTTTTCAAAGTT

Gene: Xaut_4191: TonB-dependent haem/haemoglobin receptor
TonB-dependent haem/haemoglobin receptor
SMc01518
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA2125: Hypothetical, distant similarity with heme-degrading oxygenase IsdG
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Hypothetical, distant similarity with heme-degrading oxygenase IsdG
Atu2462
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA2126: Putative heme iron utilization protein
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
hypothetical protein
exbB1
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA2127: putative exbB, uptake of enterochelin; tonB-dependent uptake of B colicins
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
putative exbB, uptake of enterochelin; tonB-dependent uptake of B colicins
exbD1
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA2128: biopolymer transport protein ExbD/TolR
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
biopolymer transport protein ExbD/TolR
tonB
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA2129: possible energy transducer TonB, C-terminal region
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
possible energy transducer TonB, C-terminal region
 
CRON 8.
rirA
*
Sinorhizobium meliloti 1021

Site:
position = -72
score = 5.86709
sequence = TTTTTGGAATTGTTCCAAACT

Gene: SMc00785: Iron-responsive transcriptional regulator RirA, Rrf2 family
*
Rhizobium sp. NGR234

Site:
position = -72
score = 5.64133
sequence = CTTTTGGAATTGTTCCAAACT

Gene: NGR_c03450: Iron-responsive transcriptional regulator RirA, Rrf2 family
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -67
score = 6.08676
sequence = ATTTTGGAATTGTTCAAAACT

Gene: RL0777: Iron-responsive transcriptional regulator RirA, Rrf2 family
*
Rhizobium etli CFN 42

Site:
position = -69
score = 6.08676
sequence = ATTTTGGAATTGTTCAAAACT

Gene: RHE_CH00735: Iron-responsive transcriptional regulator RirA, Rrf2 family
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -66
score = 5.70729
sequence = TTTCTGGAATTGTTCTAAACT

Gene: Atu0201: Iron-responsive transcriptional regulator RirA, Rrf2 family
 
Mesorhizobium sp. BNC1

Gene: Meso_1445: Iron-responsive transcriptional regulator RirA, Rrf2 family
*
Mesorhizobium loti MAFF303099

Site:
position = -139
score = 5.12701
sequence = AGTCTGGAATTGTTCCAAGGT

Gene: mlr1147: Iron-responsive transcriptional regulator RirA, Rrf2 family
*
Brucella melitensis 16M

Site:
position = -162
score = 5.59658
sequence = TTTTAAGAATGATTCTAAAGT

Gene: BMEII0707: Iron-responsive transcriptional regulator RirA, Rrf2 family
 
Bartonella quintana str. Toulouse

Gene: BQ04990: Iron-responsive transcriptional regulator RirA, Rrf2 family
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Iron-responsive transcriptional regulator RirA, Rrf2 family
 
CRON 9.
hemA
*
Sinorhizobium meliloti 1021

Site:
position = -246
score = 6.00568
sequence = ATTTTGGAATGGTTCAAAACT

Gene: SMc03104: 5-aminolevulinate synthase (EC 2.3.1.37)
*
Rhizobium sp. NGR234

Site:
position = -112
score = 5.71284
sequence = GTTTTGGAATAGTTCAAAACT

Gene: NGR_c30700: 5-aminolevulinate synthase (EC 2.3.1.37)
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -118
score = 5.44169
sequence = TATCTGGAATCATTCAAAACT

Gene: RL4379: 5-aminolevulinate synthase (EC 2.3.1.37)
*
Rhizobium etli CFN 42

Site:
position = -118
score = 5.23153
sequence = TGTCTGGAATCATTCAAAAAA

Gene: RHE_CH03846: 5-aminolevulinate synthase (EC 2.3.1.37)
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -117
score = 5.24458
sequence = TTATTGGAATGGTTCAAAACA

Gene: Atu2613: 5-aminolevulinate synthase (EC 2.3.1.37)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
5-aminolevulinate synthase (EC 2.3.1.37)
 
CRON 10.
fbpA
*
Sinorhizobium meliloti 1021

Site:
position = -148
score = 5.86709
sequence = AGTTTGGAACAATTCCAAAAA

Gene: SMc00784: Ferric iron ABC transporter, periplasmic protein
*
Rhizobium sp. NGR234

Site:
position = -135
score = 5.64133
sequence = AGTTTGGAACAATTCCAAAAG

Gene: NGR_c03440: Ferric iron ABC transporter, periplasmic protein
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -113
score = 5.70729
sequence = AGTTTAGAACAATTCCAGAAA

Gene: Atu0202: Ferric iron ABC transporter, periplasmic protein
*
Mesorhizobium sp. BNC1

Site:
position = -143
score = 6.94152
sequence = AGTTTAGAATAATTCTAAACT

Gene: Meso_0170: Ferric iron ABC transporter, periplasmic protein
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M

Gene: BMEII0584: Ferric iron ABC transporter, periplasmic protein
 
Bartonella quintana str. Toulouse
*
Rhodopseudomonas palustris CGA009

Site:
position = -98
score = 4.24401
sequence = cGgcTgGAATagTTCTAAtCg

Gene: RPA4152: Ferric iron ABC transporter, periplasmic protein
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 2
Azorhizobium caulinodans ORS 571

Gene: AZC_2245: Ferric iron ABC transporter, periplasmic protein

Gene: AZC_3358: Ferric iron ABC transporter, periplasmic protein
*
Xanthobacter autotrophicus Py2

Site:
position = -149
score = 4.52453
sequence = TAATTGGAACGATTTCAAAGA

Gene: Xaut_3764: Ferric iron ABC transporter, periplasmic protein
Ferric iron ABC transporter, periplasmic protein
fbpB
 
Sinorhizobium meliloti 1021

Gene: SMc00775: Ferric iron ABC transporter, permease protein
 
Rhizobium sp. NGR234

Gene: NGR_c03340: Ferric iron ABC transporter, permease protein
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0613: Ferric iron ABC transporter, permease protein
 
Mesorhizobium sp. BNC1

Gene: Meso_0169: Ferric iron ABC transporter, permease protein
 
Mesorhizobium loti MAFF303099

Gene: mll5301: Ferric iron ABC transporter, permease protein
 
Brucella melitensis 16M

Gene: BMEII0585: Ferric iron ABC transporter, permease protein
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA4153: Ferric iron ABC transporter, permease protein
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_2244: Ferric iron ABC transporter, permease protein
 
Xanthobacter autotrophicus Py2

Gene: Xaut_3763: Ferric iron ABC transporter, permease protein
Ferric iron ABC transporter, permease protein
 
CRON 11.
irr
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA0424: Iron-responsive regulator Irr
 
Bradyrhizobium japonicum USDA 110

Gene: bll0768: Iron-responsive regulator Irr
*
Bradyrhizobium sp. BTAi1

Site:
position = -102
score = 4.30758
sequence = AGTTTAGGGGCGTTCTAGATC

Gene: BBta_0071: Iron-responsive regulator Irr
*
Nitrobacter winogradskyi Nb-255

Site:
position = -112
score = 4.6013
sequence = AGTTTTGAGCCATTCTAGTTG

Gene: Nwi_0035: Iron-responsive regulator Irr
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Iron-responsive regulator Irr
 
CRON 12.
PF00033
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
*
Mesorhizobium loti MAFF303099

Site:
position = -32
score = 5.3398
sequence = AGCTTAGAAATCTTCAAAACT

Gene: mlr4647: cytochrome b561
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110

Gene: blr4955: cytochrome b561
 
Bradyrhizobium sp. BTAi1

Gene: BBta_5571: cytochrome b561
 
Nitrobacter winogradskyi Nb-255
*
Azorhizobium caulinodans ORS 571

Site:
position = -38
score = 5.19217
sequence = AGTCTGGACCGGTTCTAAACA

Gene: AZC_4058: cytochrome b561
*
Xanthobacter autotrophicus Py2

Site:
position = -8
score = 5.20256
sequence = TTTTTAGAATGAATCAAAATA

Gene: Xaut_1186: cytochrome b561
cytochrome b561
 
CRON 13.
hemH
*
Sinorhizobium meliloti 1021

Site:
position = -65
score = 5.35948
sequence = TTTTTAGAAGGATTTGAAACT

Gene: SMc04019: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)
*
Rhizobium sp. NGR234

Site:
position = -61
score = 5.35948
sequence = TTTTTAGAAGGATTTGAAACT

Gene: NGR_c28500: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL4076: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)
 
Rhizobium etli CFN 42

Gene: RHE_CH03556: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu3771: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)
 
Mesorhizobium sp. BNC1

Gene: Meso_2724: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)
 
Mesorhizobium loti MAFF303099

Gene: mlr3019: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)
 
Brucella melitensis 16M

Gene: BMEII0018: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)
 
Bartonella quintana str. Toulouse

Gene: BQ03600: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)
 
Rhodopseudomonas palustris CGA009

Gene: RPA0875: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)
 
Bradyrhizobium japonicum USDA 110

Gene: bll7752: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_1357: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_0928: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_4272: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_2814: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)
Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)
 
CRON 14.
irp6A
*
Sinorhizobium meliloti 1021

Site:
position = -86
score = 5.32751
sequence = TGTTTGGAAGCGTTCTAAAAG

Gene: SMb21432: Iron ABC transporter periplasmic protein
*
Rhizobium sp. NGR234

Site:
position = -86
score = 5.32751
sequence = TGTTTGGAAGGGTTCTAAAAG

Gene: NGR_b11200: Iron ABC transporter periplasmic protein
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -89
score = 5.10609
sequence = AGTTAAGAATGGCTCTAAAAC

Gene: Atu3391: Iron ABC transporter periplasmic protein
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Iron ABC transporter periplasmic protein
irp6A
 
Sinorhizobium meliloti 1021

Gene: SMb21431: Iron ABC transporter periplasmic protein
 
Rhizobium sp. NGR234

Gene: NGR_b11210: Iron ABC transporter periplasmic protein
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -92
score = 4.88254
sequence = AGTTTGGAAACGCTCTAAAAC

Gene: RL2713: Iron ABC transporter periplasmic protein
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu3390: Iron ABC transporter periplasmic protein
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Iron ABC transporter periplasmic protein
irp6B
 
Sinorhizobium meliloti 1021

Gene: SMb21430: Iron ABC transporter permease component
 
Rhizobium sp. NGR234

Gene: NGR_b11220: Iron ABC transporter permease component
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL2714: Iron ABC transporter permease component
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu3389: Iron ABC transporter permease component
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Iron ABC transporter permease component
irp6C
 
Sinorhizobium meliloti 1021

Gene: SMb21429: Iron ABC transporter, ATP-binding protein
 
Rhizobium sp. NGR234

Gene: NGR_b11230: Iron ABC transporter, ATP-binding protein
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL2715: Iron ABC transporter, ATP-binding protein
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu3388: Iron ABC transporter, ATP-binding protein
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Iron ABC transporter, ATP-binding protein
 
CRON 15.
fhuA1
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
*
Bradyrhizobium japonicum USDA 110

Site:
position = -169
score = 4.7786
sequence = CGTCTAGAAGGATTCCAAATC

Gene: blr4504: Outer membrane receptor for ferrienterochelin and colicins
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Outer membrane receptor for ferrienterochelin and colicins
 
CRON 16.
fumA
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -54
score = 4.94309
sequence = GATTTAGACCGGTTCCAATCT

Gene: RL2703: Fumarate hydratase class I, aerobic (EC 4.2.1.2)
*
Rhizobium etli CFN 42

Site:
position = -156
score = 4.62425
sequence = CATTTAGATCGGTTCCAATTT

Gene: RHE_CH02385: Fumarate hydratase class I, aerobic (EC 4.2.1.2)
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M

Gene: BMEI1016: Fumarate hydratase class I, aerobic (EC 4.2.1.2)
 
Bartonella quintana str. Toulouse
*
Rhodopseudomonas palustris CGA009

Site:
position = -82
score = 3.82485
sequence = CCCTTAGAGGTATACTAAATG

Gene: RPA3876: Fumarate hydratase class I, aerobic (EC 4.2.1.2)
*
Bradyrhizobium japonicum USDA 110

Site:
position = -62
score = 4.60146
sequence = AGCTTAGAACGCTTCTATGCC

Gene: bll5796: Fumarate hydratase class I, aerobic (EC 4.2.1.2)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_5483: Fumarate hydratase class I, aerobic (EC 4.2.1.2)
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Fumarate hydratase class I, aerobic (EC 4.2.1.2)
 
CRON 17.
tpd
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1

Gene: Meso_4285: Periplasmic protein p19 involved in high-affinity Fe2+ transport
 
Mesorhizobium loti MAFF303099
*
Brucella melitensis 16M

Site:
position = -137
score = 6.02482
sequence = TGTTTAGAATTGATCTAAACT

Gene: BMEII0885: Periplasmic protein p19 involved in high-affinity Fe2+ transport
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Periplasmic protein p19 involved in high-affinity Fe2+ transport
Meso_4286
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1

Gene: Meso_4286: putative exported protein
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M

Gene: BMEII0884: putative exported protein
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
putative exported protein
ftr1
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1

Gene: Meso_4287: High-affinity Fe2+/Pb2+ permease
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M

Gene: BMEII0883: High-affinity Fe2+/Pb2+ permease
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
High-affinity Fe2+/Pb2+ permease
COG0348
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1

Gene: Meso_4288: Polyferredoxin
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M

Gene: BMEII0882: Polyferredoxin
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Polyferredoxin
 
CRON 18.
irgA
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -92
score = 5.74759
sequence = AATTTAGAACTGTTCGAAAAC

Gene: Atu3916: iron-regulated outer membrane receptor irgA
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
iron-regulated outer membrane receptor irgA
 
CRON 19.
fiu
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
*
Bradyrhizobium japonicum USDA 110

Site:
position = -184
score = 4.90926
sequence = GTTTTAGAACGACTCCAATTT

Site:
position = -162
score = 5.6764
sequence = ACTTTAGAACCGTTTGAAACT

Site:
position = -139
score = 4.91374
sequence = AGATTAGAATCGTTTTGATCT

Gene: blr3904: TonB-dependent siderophore recepror
*
Bradyrhizobium sp. BTAi1

Site:
position = -157
score = 4.99134
sequence = TTTTTAGAATTGTTTTGATCT

Site:
position = -199
score = 4.86993
sequence = GTTTTAGAACGATTTCAAGTT

Gene: BBta_3540: TonB-dependent siderophore recepror
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
TonB-dependent siderophore recepror
piuC
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110

Gene: blr3905: Hydrolase, involved in iron uptake
 
Bradyrhizobium sp. BTAi1

Gene: BBta_3541: Hydrolase, involved in iron uptake
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Hydrolase, involved in iron uptake
exbB2
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA3478: Ferric siderophore transport system, proton channel
 
Bradyrhizobium japonicum USDA 110

Gene: blr3906: Ferric siderophore transport system, proton channel
 
Bradyrhizobium sp. BTAi1

Gene: BBta_3543: Ferric siderophore transport system, proton channel
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1267: Ferric siderophore transport system, proton channel
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Ferric siderophore transport system, proton channel
exbD2
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA3477: biopolymer transport protein ExbD
 
Bradyrhizobium japonicum USDA 110

Gene: blr3907: biopolymer transport protein ExbD
 
Bradyrhizobium sp. BTAi1

Gene: BBta_3544: biopolymer transport protein ExbD
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1268: biopolymer transport protein ExbD
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
biopolymer transport protein ExbD
tonB2
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA3476: Ferric siderophore transport system energy transducer
 
Bradyrhizobium japonicum USDA 110

Gene: blr3908: Ferric siderophore transport system energy transducer
 
Bradyrhizobium sp. BTAi1

Gene: BBta_3545: Ferric siderophore transport system energy transducer
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1269: Ferric siderophore transport system energy transducer
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Ferric siderophore transport system energy transducer
 
CRON 20.
hmuP
 
Sinorhizobium meliloti 1021

Gene: SMc01747: Hemin ABC transporter, hemin uptake protein
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL3696: Hemin ABC transporter, hemin uptake protein
 
Rhizobium etli CFN 42

Gene: RHE_CH03267: Hemin ABC transporter, hemin uptake protein
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1

Gene: Meso_1441: Hemin ABC transporter, hemin uptake protein
 
Mesorhizobium loti MAFF303099

Gene: msl1154: Hemin ABC transporter, hemin uptake protein
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA2121: Hemin ABC transporter, hemin uptake protein
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
*
Azorhizobium caulinodans ORS 571

Site:
position = -77
score = 4.98254
sequence = AATATTGAATCGCTCTAAAGT

Site:
position = -17
score = 4.9955
sequence = AGTTTGGAGTCATTCAAATGA

Gene: AZC_1578: Hemin ABC transporter, hemin uptake protein
*
Xanthobacter autotrophicus Py2

Site:
position = -19
score = 4.5306
sequence = GATCTGGAGCGATTCAAAAAT

Site:
position = -78
score = 5.67285
sequence = AGTATTGAATACTTCTAAACT

Gene: Xaut_4550: Hemin ABC transporter, hemin uptake protein
Hemin ABC transporter, hemin uptake protein
 
CRON 21.
ftr1
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1

Gene: BBta_0304: High-affinity Fe2+/Pb2+ permease
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_2743: High-affinity Fe2+/Pb2+ permease
*
Xanthobacter autotrophicus Py2

Site:
position = -238
score = 5.5319
sequence = TGATTTGAACAATTCAAAACA

Site:
position = -125
score = 4.77649
sequence = GTTTTGGAAATGTTCAAATCT

Gene: Xaut_3198: High-affinity Fe2+/Pb2+ permease
High-affinity Fe2+/Pb2+ permease
 
CRON 22.
SMc00065
 
Sinorhizobium meliloti 1021

Gene: SMc00065: Hypothetical signal peptide protein
 
Rhizobium sp. NGR234

Gene: NGR_c07750: Hypothetical signal peptide protein
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -107
score = 5.46495
sequence = AGTCGAGAACAGTTCTAAACA

Gene: RL1432: Hypothetical signal peptide protein
 
Rhizobium etli CFN 42

Gene: RHE_CH01285: Hypothetical signal peptide protein
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu8142: Hypothetical signal peptide protein
 
Mesorhizobium sp. BNC1

Gene: Meso_0893: Hypothetical signal peptide protein
 
Mesorhizobium loti MAFF303099

Gene: msr7683: Hypothetical signal peptide protein
 
Brucella melitensis 16M

Gene: BMEI1338: Hypothetical signal peptide protein
 
Bartonella quintana str. Toulouse

Gene: BQ03900: Hypothetical signal peptide protein
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Hypothetical signal peptide protein
feuP
 
Sinorhizobium meliloti 1021

Gene: SMc00458: two component transcriptional regulator
 
Rhizobium sp. NGR234

Gene: NGR_c07760: two component transcriptional regulator
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1433: two component transcriptional regulator
 
Rhizobium etli CFN 42

Gene: RHE_CH01286: two component transcriptional regulator
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0970: two component transcriptional regulator
 
Mesorhizobium sp. BNC1

Gene: Meso_0894: two component transcriptional regulator
 
Mesorhizobium loti MAFF303099

Gene: mlr7684: two component transcriptional regulator
 
Brucella melitensis 16M

Gene: BMEI1337: two component transcriptional regulator
 
Bartonella quintana str. Toulouse

Gene: BQ03910: two component transcriptional regulator
 
Rhodopseudomonas palustris CGA009

Gene: RPA1915: two component transcriptional regulator
 
Bradyrhizobium japonicum USDA 110

Gene: blr3121: two component transcriptional regulator
 
Bradyrhizobium sp. BTAi1

Gene: BBta_3067: two component transcriptional regulator
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1187: two component transcriptional regulator
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1129: two component transcriptional regulator
 
Xanthobacter autotrophicus Py2

Gene: Xaut_3176: two component transcriptional regulator
two component transcriptional regulator
feuQ
 
Sinorhizobium meliloti 1021

Gene: SMc00129: two-component sensor histidine kinase
 
Rhizobium sp. NGR234

Gene: NGR_c07770: two-component sensor histidine kinase
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1434: two-component sensor histidine kinase
 
Rhizobium etli CFN 42

Gene: RHE_CH01287: two-component sensor histidine kinase
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0971: two-component sensor histidine kinase
 
Mesorhizobium sp. BNC1

Gene: Meso_0895: two-component sensor histidine kinase
 
Mesorhizobium loti MAFF303099

Gene: mlr7686: two-component sensor histidine kinase
 
Brucella melitensis 16M

Gene: BMEI1336: two-component sensor histidine kinase
 
Bartonella quintana str. Toulouse

Gene: BQ03920: two-component sensor histidine kinase
 
Rhodopseudomonas palustris CGA009

Gene: RPA1916: two-component sensor histidine kinase
 
Bradyrhizobium japonicum USDA 110

Gene: blr3122: two-component sensor histidine kinase
 
Bradyrhizobium sp. BTAi1

Gene: BBta_3068: two-component sensor histidine kinase
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1188: two-component sensor histidine kinase
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1130: two-component sensor histidine kinase
 
Xanthobacter autotrophicus Py2

Gene: Xaut_3177: two-component sensor histidine kinase
two-component sensor histidine kinase
lipA
 
Sinorhizobium meliloti 1021

Gene: SMc00067: outer membrane lipoprotein
 
Rhizobium sp. NGR234

Gene: NGR_c07780: outer membrane lipoprotein
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1435: outer membrane lipoprotein
 
Rhizobium etli CFN 42

Gene: RHE_CH01288: outer membrane lipoprotein
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0972: outer membrane lipoprotein
 
Mesorhizobium sp. BNC1

Gene: Meso_0896: outer membrane lipoprotein
 
Mesorhizobium loti MAFF303099

Gene: mlr7687: outer membrane lipoprotein
 
Brucella melitensis 16M

Gene: BMEI1335: outer membrane lipoprotein
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1131: outer membrane lipoprotein
 
Xanthobacter autotrophicus Py2

Gene: Xaut_3178: outer membrane lipoprotein
outer membrane lipoprotein
cycH
 
Sinorhizobium meliloti 1021

Gene: SMc02361: Cytochrome c heme lyase subunit CcmH
 
Rhizobium sp. NGR234

Gene: NGR_c07790: Cytochrome c heme lyase subunit CcmH
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1436: Cytochrome c heme lyase subunit CcmH
 
Rhizobium etli CFN 42

Gene: RHE_CH01289: Cytochrome c heme lyase subunit CcmH
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0973: Cytochrome c heme lyase subunit CcmH
 
Mesorhizobium sp. BNC1

Gene: Meso_0897: Cytochrome c heme lyase subunit CcmH
 
Mesorhizobium loti MAFF303099

Gene: mlr7688: Cytochrome c heme lyase subunit CcmH
 
Brucella melitensis 16M

Gene: BMEI1334: Cytochrome c heme lyase subunit CcmH
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA1919: Cytochrome c heme lyase subunit CcmH
 
Bradyrhizobium japonicum USDA 110

Gene: blr3125: Cytochrome c heme lyase subunit CcmH
 
Bradyrhizobium sp. BTAi1

Gene: BBta_3071: Cytochrome c heme lyase subunit CcmH
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1191: Cytochrome c heme lyase subunit CcmH
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1132: Cytochrome c heme lyase subunit CcmH
 
Xanthobacter autotrophicus Py2

Gene: Xaut_1655: Cytochrome c heme lyase subunit CcmH
Cytochrome c heme lyase subunit CcmH
cycJ
 
Sinorhizobium meliloti 1021

Gene: SMc02362: Cytochrome c-type biogenesis protein, heme chaperone
 
Rhizobium sp. NGR234

Gene: NGR_c07800: Cytochrome c-type biogenesis protein, heme chaperone
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1437: Cytochrome c-type biogenesis protein, heme chaperone
 
Rhizobium etli CFN 42

Gene: RHE_CH01290: Cytochrome c-type biogenesis protein, heme chaperone
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0974: Cytochrome c-type biogenesis protein, heme chaperone
 
Mesorhizobium sp. BNC1

Gene: Meso_0898: Cytochrome c-type biogenesis protein, heme chaperone
 
Mesorhizobium loti MAFF303099

Gene: mlr7689: Cytochrome c-type biogenesis protein, heme chaperone
 
Brucella melitensis 16M

Gene: BMEI1333: Cytochrome c-type biogenesis protein, heme chaperone
 
Bartonella quintana str. Toulouse

Gene: BQ03940: Cytochrome c-type biogenesis protein, heme chaperone
 
Rhodopseudomonas palustris CGA009

Gene: RPA1920: Cytochrome c-type biogenesis protein, heme chaperone
 
Bradyrhizobium japonicum USDA 110

Gene: blr3126: Cytochrome c-type biogenesis protein, heme chaperone
 
Bradyrhizobium sp. BTAi1

Gene: BBta_3072: Cytochrome c-type biogenesis protein, heme chaperone
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1192: Cytochrome c-type biogenesis protein, heme chaperone
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1133: Cytochrome c-type biogenesis protein, heme chaperone
 
Xanthobacter autotrophicus Py2

Gene: Xaut_1656: Cytochrome c-type biogenesis protein, heme chaperone
Cytochrome c-type biogenesis protein, heme chaperone
cycK
 
Sinorhizobium meliloti 1021

Gene: SMc02363: Cytochrome c heme lyase subunit cycK
 
Rhizobium sp. NGR234

Gene: NGR_c07810: Cytochrome c heme lyase subunit cycK
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1438: Cytochrome c heme lyase subunit cycK
 
Rhizobium etli CFN 42

Gene: RHE_CH01291: Cytochrome c heme lyase subunit cycK
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0975: Cytochrome c heme lyase subunit cycK
 
Mesorhizobium sp. BNC1

Gene: Meso_0899: Cytochrome c heme lyase subunit cycK
 
Mesorhizobium loti MAFF303099

Gene: mlr7690: Cytochrome c heme lyase subunit cycK
 
Brucella melitensis 16M

Gene: BMEI1332: Cytochrome c heme lyase subunit cycK
 
Bartonella quintana str. Toulouse

Gene: BQ03950: Cytochrome c heme lyase subunit cycK
 
Rhodopseudomonas palustris CGA009

Gene: RPA1921: Cytochrome c heme lyase subunit cycK
 
Bradyrhizobium japonicum USDA 110

Gene: blr3127: Cytochrome c heme lyase subunit cycK
 
Bradyrhizobium sp. BTAi1

Gene: BBta_3073: Cytochrome c heme lyase subunit cycK
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1193: Cytochrome c heme lyase subunit cycK
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1134: Cytochrome c heme lyase subunit cycK
 
Xanthobacter autotrophicus Py2

Gene: Xaut_1657: Cytochrome c heme lyase subunit cycK
Cytochrome c heme lyase subunit cycK
cycL
 
Sinorhizobium meliloti 1021

Gene: SMc02364: Cytochrome c heme lyase subunit CcmL
 
Rhizobium sp. NGR234

Gene: NGR_c07820: Cytochrome c heme lyase subunit CcmL
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1439: Cytochrome c heme lyase subunit CcmL
 
Rhizobium etli CFN 42

Gene: RHE_CH01292: Cytochrome c heme lyase subunit CcmL
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0976: Cytochrome c heme lyase subunit CcmL
 
Mesorhizobium sp. BNC1

Gene: Meso_0900: Cytochrome c heme lyase subunit CcmL
 
Mesorhizobium loti MAFF303099

Gene: mlr7691: Cytochrome c heme lyase subunit CcmL
 
Brucella melitensis 16M

Gene: BMEI1331: Cytochrome c heme lyase subunit CcmL
 
Bartonella quintana str. Toulouse

Gene: BQ03960: Cytochrome c heme lyase subunit CcmL
 
Rhodopseudomonas palustris CGA009

Gene: RPA1922: Cytochrome c heme lyase subunit CcmL
 
Bradyrhizobium japonicum USDA 110

Gene: blr3128: Cytochrome c heme lyase subunit CcmL
 
Bradyrhizobium sp. BTAi1

Gene: BBta_3074: Cytochrome c heme lyase subunit CcmL
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1194: Cytochrome c heme lyase subunit CcmL
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1135: Cytochrome c heme lyase subunit CcmL
 
Xanthobacter autotrophicus Py2

Gene: Xaut_1658: Cytochrome c heme lyase subunit CcmL
Cytochrome c heme lyase subunit CcmL
 
CRON 23.
fdx
 
Sinorhizobium meliloti 1021

Gene: SMc00192: Ferredoxin, 2Fe-2S
 
Rhizobium sp. NGR234

Gene: NGR_c16660: Ferredoxin, 2Fe-2S
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL2652: Ferredoxin, 2Fe-2S
 
Rhizobium etli CFN 42

Gene: RHE_CH02338: Ferredoxin, 2Fe-2S
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -39
score = 5.42618
sequence = TGTTTAGAACAATTCTCAGAT

Gene: Atu1350: Ferredoxin, 2Fe-2S
 
Mesorhizobium sp. BNC1

Gene: Meso_1410: Ferredoxin, 2Fe-2S
 
Mesorhizobium loti MAFF303099

Gene: msl0793: Ferredoxin, 2Fe-2S
 
Brucella melitensis 16M

Gene: BMEI0959: Ferredoxin, 2Fe-2S
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA3956: Ferredoxin, 2Fe-2S
 
Bradyrhizobium japonicum USDA 110

Gene: bll5885: Ferredoxin, 2Fe-2S
 
Bradyrhizobium sp. BTAi1

Gene: BBta_5552: Ferredoxin, 2Fe-2S
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1088: Ferredoxin, 2Fe-2S
 
Azorhizobium caulinodans ORS 571

Gene: AZC_2219: Ferredoxin, 2Fe-2S
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4124: Ferredoxin, 2Fe-2S
Ferredoxin, 2Fe-2S
 
CRON 24.
iorAB
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
*
Rhodopseudomonas palustris CGA009

Site:
position = -74
score = 5.33447
sequence = AGCTTAGACTGGTTCGAAACA

Gene: RPA3195: Indolepyruvate ferredoxin oxidoreductase, alpha and beta subunits
 
Bradyrhizobium japonicum USDA 110

Gene: bll5338: Indolepyruvate ferredoxin oxidoreductase, alpha and beta subunits
 
Bradyrhizobium sp. BTAi1

Gene: BBta_5013: Indolepyruvate ferredoxin oxidoreductase, alpha and beta subunits
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1745: Indolepyruvate ferredoxin oxidoreductase, alpha and beta subunits
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Indolepyruvate ferredoxin oxidoreductase, alpha and beta subunits
 
CRON 25.
fhuA3
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA4430: Ferrichrome-iron outer membrane receptor
*
Bradyrhizobium japonicum USDA 110

Site:
position = -116
score = 5.13388
sequence = CGCTTAGAACCATTCAACACT

Gene: bll7968: Ferrichrome-iron outer membrane receptor
 
Bradyrhizobium sp. BTAi1

Gene: BBta_6052: Ferrichrome-iron outer membrane receptor
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_0182: Ferrichrome-iron outer membrane receptor
 
Xanthobacter autotrophicus Py2
Ferrichrome-iron outer membrane receptor
piuB
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA4429: Uncharacterized iron-regulated membrane protein; Iron-uptake factor PiuB
 
Bradyrhizobium japonicum USDA 110

Gene: bll7967: Uncharacterized iron-regulated membrane protein; Iron-uptake factor PiuB
 
Bradyrhizobium sp. BTAi1

Gene: BBta_6053: Uncharacterized iron-regulated membrane protein; Iron-uptake factor PiuB
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Uncharacterized iron-regulated membrane protein; Iron-uptake factor PiuB
 
CRON 26.
coxS
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
*
Bradyrhizobium japonicum USDA 110

Site:
position = -52
score = 5.08099
sequence = TGATTTGAACAGTTCCAATTT

Gene: bll2737: Isoquinoline 1-oxidoreductase alpha subunit (EC 1.3.99.16)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_2767: Isoquinoline 1-oxidoreductase alpha subunit (EC 1.3.99.16)
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_3275: Isoquinoline 1-oxidoreductase alpha subunit (EC 1.3.99.16)
 
Xanthobacter autotrophicus Py2
Isoquinoline 1-oxidoreductase alpha subunit (EC 1.3.99.16)
coxL
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110

Gene: bll2736: Isoquinoline 1-oxidoreductase beta subunit (EC 1.3.99.16)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_2766: Isoquinoline 1-oxidoreductase beta subunit (EC 1.3.99.16)
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_3274: Isoquinoline 1-oxidoreductase beta subunit (EC 1.3.99.16)
 
Xanthobacter autotrophicus Py2
Isoquinoline 1-oxidoreductase beta subunit (EC 1.3.99.16)
 
CRON 27.
katG
 
Sinorhizobium meliloti 1021

Gene: SMa2379: Catalase (EC 1.11.1.6) / Peroxidase (EC 1.11.1.7)
 
Rhizobium sp. NGR234

Gene: NGR_b06410: Catalase (EC 1.11.1.6) / Peroxidase (EC 1.11.1.7)
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42

Gene: RHE_PF00004: Catalase (EC 1.11.1.6) / Peroxidase (EC 1.11.1.7)
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
*
Mesorhizobium loti MAFF303099

Site:
position = -22
score = 5.06044
sequence = AGTCTGGAATCGTTCCAGATT

Gene: mlr6940: Catalase (EC 1.11.1.6) / Peroxidase (EC 1.11.1.7)
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1

Gene: BBta_6389: Catalase (EC 1.11.1.6) / Peroxidase (EC 1.11.1.7)
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Catalase (EC 1.11.1.6) / Peroxidase (EC 1.11.1.7)
 
CRON 28.
feoA
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
*
Rhodopseudomonas palustris CGA009

Site:
position = -79
score = 4.90752
sequence = CTGTTACAATCGTTCTAAACT

Gene: RPA4636: Ferrous iron transport protein A
*
Bradyrhizobium japonicum USDA 110

Site:
position = -79
score = 5.03425
sequence = ACTTTAAAATCACTCTAAGGT

Gene: bsr6522: Ferrous iron transport protein A
*
Bradyrhizobium sp. BTAi1

Site:
position = -79
score = 5.05497
sequence = TGTTTAAAATCGCTCTAAGAT

Gene: BBta_6109: Ferrous iron transport protein A
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_2976: Ferrous iron transport protein A
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Ferrous iron transport protein A
feoB
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA4635: Ferrous iron transport protein B
 
Bradyrhizobium japonicum USDA 110

Gene: blr6523: Ferrous iron transport protein B
 
Bradyrhizobium sp. BTAi1

Gene: BBta_6110: Ferrous iron transport protein B
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_2975: Ferrous iron transport protein B
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Ferrous iron transport protein B
 
CRON 29.
cbrA
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
*
Azorhizobium caulinodans ORS 571

Site:
position = -155
score = 5.11583
sequence = TGTTTGGAATAAATCGAAAAA

Gene: AZC_0183: iron siderophore ABC transporter, ATPase protein
 
Xanthobacter autotrophicus Py2
iron siderophore ABC transporter, ATPase protein
cbrB
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_0184: iron siderophore ABC transporter, permease protein
 
Xanthobacter autotrophicus Py2
iron siderophore ABC transporter, permease protein
cbrC
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_0185: iron siderophore ABC transporter, permease protein
 
Xanthobacter autotrophicus Py2
iron siderophore ABC transporter, permease protein
cbrD
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_0186: iron siderophore ABC transporter, substrate bindiing protein
 
Xanthobacter autotrophicus Py2
iron siderophore ABC transporter, substrate bindiing protein
 
CRON 30.
iprA
*
Sinorhizobium meliloti 1021

Site:
position = -118
score = 4.87435
sequence = AACTTCAAGCCGTTCTAAACT

Gene: SMc00402: Iron-regulated protein A precursor
*
Rhizobium sp. NGR234

Site:
position = -114
score = 5.35005
sequence = AATTTGAAAATGTTCTAAACT

Gene: NGR_c36600: Iron-regulated protein A precursor
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -207
score = 5.2975
sequence = TTCTTAAAATCATTCCAAACT

Gene: RL0322: Iron-regulated protein A precursor
*
Rhizobium etli CFN 42

Site:
position = -99
score = 5.57308
sequence = ATCTTAAAATTATTCCAAACT

Gene: RHE_CH00304: Iron-regulated protein A precursor
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -107
score = 5.54056
sequence = TGTTTCAAAGCATTCTAAACT

Gene: Atu0288: Iron-regulated protein A precursor
 
Mesorhizobium sp. BNC1

Gene: Meso_0643: Iron-regulated protein A precursor
*
Mesorhizobium loti MAFF303099

Site:
position = -244
score = 6.94152
sequence = AGTTTAGAATAATTCTAAACT

Gene: mlr5523: Iron-regulated protein A precursor
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_2744: Iron-regulated protein A precursor
 
Xanthobacter autotrophicus Py2

Gene: Xaut_3197: Iron-regulated protein A precursor
Iron-regulated protein A precursor
bfd
*
Sinorhizobium meliloti 1021

Site:
position = -119
score = 5.32431
sequence = AGTTTAGAATCGCTCTAATGC

Gene: SMc03787: [2Fe-2S]-binding protein, bacterioferritin
*
Rhizobium sp. NGR234

Site:
position = -62
score = 5.38457
sequence = AGATTAGAACGACTCTAATAT

Gene: NGR_c31850: [2Fe-2S]-binding protein, bacterioferritin
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL4696: [2Fe-2S]-binding protein, bacterioferritin
 
Rhizobium etli CFN 42

Gene: RHE_CH04082: [2Fe-2S]-binding protein, bacterioferritin
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1

Gene: Meso_4047: [2Fe-2S]-binding protein, bacterioferritin
 
Mesorhizobium loti MAFF303099

Gene: msr5525: [2Fe-2S]-binding protein, bacterioferritin
 
Brucella melitensis 16M

Gene: BMEII0705: [2Fe-2S]-binding protein, bacterioferritin
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
*
Bradyrhizobium japonicum USDA 110

Site:
position = -96
score = 4.94386
sequence = AGTTTGGAATAGCTTCAAATA

Site:
position = -128
score = 5.16991
sequence = ATTTTAGAGCCGTTCTAGGCT

Gene: bsl6681: [2Fe-2S]-binding protein, bacterioferritin
*
Bradyrhizobium sp. BTAi1

Site:
position = 94
score = 4.33034
sequence = AGaTTgGAATAgcTtcAAAag

Gene: BBta_6243: [2Fe-2S]-binding protein, bacterioferritin
*
Nitrobacter winogradskyi Nb-255

Site:
position = -100
score = 5.10929
sequence = AGTTTGGAATAGCTTGAAACA

Gene: Nwi_2476: [2Fe-2S]-binding protein, bacterioferritin
 
Azorhizobium caulinodans ORS 571
*
Xanthobacter autotrophicus Py2

Site:
position = -34
score = 4.72872
sequence = TTTTTAGAAGCTTTCCAATTT

Gene: Xaut_3766: [2Fe-2S]-binding protein, bacterioferritin
[2Fe-2S]-binding protein, bacterioferritin
bfr
 
Sinorhizobium meliloti 1021

Gene: SMc03786: Bacterioferritin
 
Rhizobium sp. NGR234

Gene: NGR_c31840: Bacterioferritin
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL4695: Bacterioferritin
 
Rhizobium etli CFN 42

Gene: RHE_CH04081: Bacterioferritin
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2771: Bacterioferritin
 
Mesorhizobium sp. BNC1

Gene: Meso_4048: Bacterioferritin
 
Mesorhizobium loti MAFF303099

Gene: mlr5526: Bacterioferritin
 
Brucella melitensis 16M

Gene: BMEII0704: Bacterioferritin
 
Bartonella quintana str. Toulouse
*
Rhodopseudomonas palustris CGA009

Site:
position = -67
score = 5.02285
sequence = GATCTAGAATTATTCTAATTC

Gene: RPA3600: Bacterioferritin
*
Bradyrhizobium japonicum USDA 110

Site:
position = -62
score = 5.68031
sequence = CATTTAGAAGCGTTCTAAATT

Gene: bll6680: Bacterioferritin
 
Bradyrhizobium sp. BTAi1

Gene: BBta_6242: Bacterioferritin
*
Nitrobacter winogradskyi Nb-255

Site:
position = -81
score = 5.89045
sequence = GATTTAGAAGTATTCTAAATT

Gene: Nwi_2475: Bacterioferritin
*
Azorhizobium caulinodans ORS 571

Site:
position = -66
score = 5.28631
sequence = AGTTTGGAATTGGTCTAATTA

Gene: AZC_2246: Bacterioferritin
 
Xanthobacter autotrophicus Py2

Gene: Xaut_3765: Bacterioferritin
Bacterioferritin
 
CRON 31.
ccmA
 
Sinorhizobium meliloti 1021

Gene: SMc03847: heme ABC transporter, ATPase subunit
 
Rhizobium sp. NGR234

Gene: NGR_c32370: heme ABC transporter, ATPase subunit
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL4537: heme ABC transporter, ATPase subunit
 
Rhizobium etli CFN 42

Gene: RHE_CH03945: heme ABC transporter, ATPase subunit
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2686: heme ABC transporter, ATPase subunit
 
Mesorhizobium sp. BNC1

Gene: Meso_3358: heme ABC transporter, ATPase subunit
*
Mesorhizobium loti MAFF303099

Site:
position = -86
score = 5.04492
sequence = TTTCTGGAATAGTTCTAGACA

Gene: mll4333: heme ABC transporter, ATPase subunit
 
Brucella melitensis 16M

Gene: BMEI1853: heme ABC transporter, ATPase subunit
*
Bartonella quintana str. Toulouse

Site:
position = -98
score = 5.18756
sequence = TTTCTAGAACTATTCTAGATA

Gene: BQ01080: heme ABC transporter, ATPase subunit
 
Rhodopseudomonas palustris CGA009

Gene: RPA0203: heme ABC transporter, ATPase subunit
 
Bradyrhizobium japonicum USDA 110

Gene: blr0467: heme ABC transporter, ATPase subunit
 
Bradyrhizobium sp. BTAi1

Gene: BBta_0381: heme ABC transporter, ATPase subunit
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_0322: heme ABC transporter, ATPase subunit
 
Azorhizobium caulinodans ORS 571

Gene: AZC_4460: heme ABC transporter, ATPase subunit
 
Xanthobacter autotrophicus Py2

Gene: Xaut_3853: heme ABC transporter, ATPase subunit
heme ABC transporter, ATPase subunit
ccmB
 
Sinorhizobium meliloti 1021

Gene: SMc03848: heme ABC transporter, permease subunit
 
Rhizobium sp. NGR234

Gene: NGR_c32360: heme ABC transporter, permease subunit
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL4538: heme ABC transporter, permease subunit
 
Rhizobium etli CFN 42

Gene: RHE_CH03947: heme ABC transporter, permease subunit
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2687: heme ABC transporter, permease subunit
 
Mesorhizobium sp. BNC1

Gene: Meso_3359: heme ABC transporter, permease subunit
 
Mesorhizobium loti MAFF303099

Gene: mll4332: heme ABC transporter, permease subunit
 
Brucella melitensis 16M

Gene: BMEI1852: heme ABC transporter, permease subunit
 
Bartonella quintana str. Toulouse

Gene: BQ01070: heme ABC transporter, permease subunit
 
Rhodopseudomonas palustris CGA009

Gene: RPA0204: heme ABC transporter, permease subunit
 
Bradyrhizobium japonicum USDA 110

Gene: blr0468: heme ABC transporter, permease subunit
 
Bradyrhizobium sp. BTAi1

Gene: BBta_0380: heme ABC transporter, permease subunit
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_0321: heme ABC transporter, permease subunit
 
Azorhizobium caulinodans ORS 571

Gene: AZC_4459: heme ABC transporter, permease subunit
 
Xanthobacter autotrophicus Py2

Gene: Xaut_3854: heme ABC transporter, permease subunit
heme ABC transporter, permease subunit
ccmC
 
Sinorhizobium meliloti 1021

Gene: SMc03849: Cytochrome c-type biogenesis protein, heme lyase
 
Rhizobium sp. NGR234

Gene: NGR_c32350: Cytochrome c-type biogenesis protein, heme lyase
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL4539: Cytochrome c-type biogenesis protein, heme lyase
 
Rhizobium etli CFN 42

Gene: RHE_CH03948: Cytochrome c-type biogenesis protein, heme lyase
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2688: Cytochrome c-type biogenesis protein, heme lyase
 
Mesorhizobium sp. BNC1

Gene: Meso_3360: Cytochrome c-type biogenesis protein, heme lyase
 
Mesorhizobium loti MAFF303099

Gene: mlr8327: Cytochrome c-type biogenesis protein, heme lyase
 
Brucella melitensis 16M

Gene: BMEI1851: Cytochrome c-type biogenesis protein, heme lyase
 
Bartonella quintana str. Toulouse

Gene: BQ01060: Cytochrome c-type biogenesis protein, heme lyase
 
Rhodopseudomonas palustris CGA009

Gene: RPA0205: Cytochrome c-type biogenesis protein, heme lyase
 
Bradyrhizobium japonicum USDA 110

Gene: blr0469: Cytochrome c-type biogenesis protein, heme lyase
 
Bradyrhizobium sp. BTAi1

Gene: BBta_0379: Cytochrome c-type biogenesis protein, heme lyase
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_0320: Cytochrome c-type biogenesis protein, heme lyase
 
Azorhizobium caulinodans ORS 571

Gene: AZC_4457: Cytochrome c-type biogenesis protein, heme lyase
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4130: Cytochrome c-type biogenesis protein, heme lyase
Cytochrome c-type biogenesis protein, heme lyase
ccmD
 
Sinorhizobium meliloti 1021

Gene: SMc03850: Cytochrome c-type biogenesis protein, interacts with CcmCE
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42

Gene: RHE_CH03949: Cytochrome c-type biogenesis protein, interacts with CcmCE
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2689: Cytochrome c-type biogenesis protein, interacts with CcmCE
 
Mesorhizobium sp. BNC1

Gene: Meso_3361: Cytochrome c-type biogenesis protein, interacts with CcmCE
 
Mesorhizobium loti MAFF303099

Gene: msl4331: Cytochrome c-type biogenesis protein, interacts with CcmCE
 
Brucella melitensis 16M

Gene: BMEI1850: Cytochrome c-type biogenesis protein, interacts with CcmCE
 
Bartonella quintana str. Toulouse

Gene: BQ01050: Cytochrome c-type biogenesis protein, interacts with CcmCE
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110

Gene: bsr0470: Cytochrome c-type biogenesis protein, interacts with CcmCE
 
Bradyrhizobium sp. BTAi1

Gene: BBta_0378: Cytochrome c-type biogenesis protein, interacts with CcmCE
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_0319: Cytochrome c-type biogenesis protein, interacts with CcmCE
 
Azorhizobium caulinodans ORS 571

Gene: AZC_4456: Cytochrome c-type biogenesis protein, interacts with CcmCE
 
Xanthobacter autotrophicus Py2
Cytochrome c-type biogenesis protein, interacts with CcmCE
ccmG
 
Sinorhizobium meliloti 1021

Gene: SMc03851: Cytochrome c-type biogenesis protein, thiol:disulfide oxidoreductase
 
Rhizobium sp. NGR234

Gene: NGR_c32340: Cytochrome c-type biogenesis protein, thiol:disulfide oxidoreductase
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL4540: Cytochrome c-type biogenesis protein, thiol:disulfide oxidoreductase
 
Rhizobium etli CFN 42

Gene: RHE_CH03950: Cytochrome c-type biogenesis protein, thiol:disulfide oxidoreductase
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2690: Cytochrome c-type biogenesis protein, thiol:disulfide oxidoreductase
 
Mesorhizobium sp. BNC1

Gene: Meso_3362: Cytochrome c-type biogenesis protein, thiol:disulfide oxidoreductase
 
Mesorhizobium loti MAFF303099

Gene: mll4330: Cytochrome c-type biogenesis protein, thiol:disulfide oxidoreductase
 
Brucella melitensis 16M

Gene: BMEI1849: Cytochrome c-type biogenesis protein, thiol:disulfide oxidoreductase
 
Bartonella quintana str. Toulouse

Gene: BQ01040: Cytochrome c-type biogenesis protein, thiol:disulfide oxidoreductase
 
Rhodopseudomonas palustris CGA009

Gene: RPA0206: Cytochrome c-type biogenesis protein, thiol:disulfide oxidoreductase
 
Bradyrhizobium japonicum USDA 110

Gene: blr0471: Cytochrome c-type biogenesis protein, thiol:disulfide oxidoreductase
 
Bradyrhizobium sp. BTAi1

Gene: BBta_0377: Cytochrome c-type biogenesis protein, thiol:disulfide oxidoreductase
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_0318: Cytochrome c-type biogenesis protein, thiol:disulfide oxidoreductase
 
Azorhizobium caulinodans ORS 571

Gene: AZC_4455: Cytochrome c-type biogenesis protein, thiol:disulfide oxidoreductase
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4129: Cytochrome c-type biogenesis protein, thiol:disulfide oxidoreductase
Cytochrome c-type biogenesis protein, thiol:disulfide oxidoreductase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD