Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog IscR - Desulfuromonadales

Properties
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Geobacter metallireducens GS-15 5 2
Geobacter sulfurreducens PCA 5 2
Geobacter uraniumreducens Rf4 3 1
Geobacter sp. FRC-32 3 1
Geobacter sp. M21
Geobacter lovleyi SZ
Pelobacter propionicus DSM 2379
Pelobacter carbinolicus str. DSM 2380 3 1
Desulfuromonas acetoxidans DSM 684 3 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
iscU
*
Geobacter metallireducens GS-15

Site:
position = -62
score = 6.42768
sequence = ATACCTGACAATTTTGCTATAGTAT

Gene: Gmet_0991: Iron-sulfur cluster assembly scaffold protein IscU
*
Geobacter sulfurreducens PCA

Site:
position = -59
score = 6.42768
sequence = ATACCTGACAATTTTGCTATAGTAT

Gene: GSU2012: Iron-sulfur cluster assembly scaffold protein IscU
 
Geobacter uraniumreducens Rf4

Gene: Gura_1832: Iron-sulfur cluster assembly scaffold protein IscU
 
Geobacter sp. FRC-32

Gene: Geob_3050: Iron-sulfur cluster assembly scaffold protein IscU
 
Geobacter sp. M21

Gene: GM21_2648: Iron-sulfur cluster assembly scaffold protein IscU
 
Geobacter lovleyi SZ

Gene: Glov_1606: Iron-sulfur cluster assembly scaffold protein IscU
 
Pelobacter propionicus DSM 2379

Gene: Ppro_2016: Iron-sulfur cluster assembly scaffold protein IscU
 
Pelobacter carbinolicus str. DSM 2380

Gene: Pcar_0051: Iron-sulfur cluster assembly scaffold protein IscU
 
Desulfuromonas acetoxidans DSM 684
Iron-sulfur cluster assembly scaffold protein IscU
iscS2
 
Geobacter metallireducens GS-15

Gene: Gmet_0992: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Geobacter sulfurreducens PCA

Gene: GSU2011: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Geobacter uraniumreducens Rf4

Gene: Gura_1833: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Geobacter sp. FRC-32

Gene: Geob_3049: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Geobacter sp. M21

Gene: GM21_2647: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Geobacter lovleyi SZ

Gene: Glov_1607: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Pelobacter propionicus DSM 2379

Gene: Ppro_2015: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Pelobacter carbinolicus str. DSM 2380

Gene: Pcar_0050: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Desulfuromonas acetoxidans DSM 684
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
CRON 2.
cysE
*
Geobacter metallireducens GS-15

Site:
position = -138
score = 7.09797
sequence = ATAGTTGACAGATTTTGTAAGGTAT

Gene: Gmet_0870: Serine acetyltransferase (EC 2.3.1.30)
*
Geobacter sulfurreducens PCA

Site:
position = -130
score = 6.45956
sequence = GAAGTTGACAAAAATTGTAGGGTAT

Gene: GSU2572: Serine acetyltransferase (EC 2.3.1.30)
*
Geobacter uraniumreducens Rf4

Site:
position = -75
score = 7.05837
sequence = ATAATTGACTAAAATAGTAAGGTAT

Gene: Gura_1495: Serine acetyltransferase (EC 2.3.1.30)
*
Geobacter sp. FRC-32

Site:
position = -69
score = 6.97942
sequence = ATAATTGACTGAAATAGTAAGGTAT

Gene: Geob_1982: Serine acetyltransferase (EC 2.3.1.30)
 
Geobacter sp. M21
 
Geobacter lovleyi SZ

Gene: Glov_2614: Serine acetyltransferase (EC 2.3.1.30)
 
Pelobacter propionicus DSM 2379

Gene: Ppro_0748: Serine acetyltransferase (EC 2.3.1.30)
*
Pelobacter carbinolicus str. DSM 2380

Site:
position = -76
score = 6.45956
sequence = ATAGTTGACAAAAATGATCAGGCAT

Gene: Pcar_1862: Serine acetyltransferase (EC 2.3.1.30)
*
Desulfuromonas acetoxidans DSM 684

Site:
position = -47
score = 6.01781
sequence = ATAGTTGACAGTTATGCTCAGGAAT

Gene: Dace_1031: Serine acetyltransferase (EC 2.3.1.30)
Serine acetyltransferase (EC 2.3.1.30)
iscR
 
Geobacter metallireducens GS-15

Gene: Gmet_0871: Iron-sulfur cluster regulator IscR
 
Geobacter sulfurreducens PCA

Gene: GSU2571: Iron-sulfur cluster regulator IscR
 
Geobacter uraniumreducens Rf4

Gene: Gura_1494: Iron-sulfur cluster regulator IscR
 
Geobacter sp. FRC-32

Gene: Geob_1981: Iron-sulfur cluster regulator IscR
 
Geobacter sp. M21
 
Geobacter lovleyi SZ
 
Pelobacter propionicus DSM 2379
 
Pelobacter carbinolicus str. DSM 2380

Gene: Pcar_1861: Iron-sulfur cluster regulator IscR
 
Desulfuromonas acetoxidans DSM 684

Gene: Dace_1030: Iron-sulfur cluster regulator IscR
Iron-sulfur cluster regulator IscR
iscS
 
Geobacter metallireducens GS-15

Gene: Gmet_0872: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Geobacter sulfurreducens PCA

Gene: GSU2570: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Geobacter uraniumreducens Rf4

Gene: Gura_1493: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Geobacter sp. FRC-32

Gene: Geob_1980: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Geobacter sp. M21
 
Geobacter lovleyi SZ
 
Pelobacter propionicus DSM 2379
 
Pelobacter carbinolicus str. DSM 2380

Gene: Pcar_1860: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Desulfuromonas acetoxidans DSM 684

Gene: Dace_1029: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD