Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog IscR - Caulobacterales

Properties
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Caulobacter crescentus CB15 1 1
Caulobacter segnis ATCC 21756 8 1
Caulobacter sp. K31 10 1
Phenylobacterium zucineum HLK1 8 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
iscR
*
Caulobacter crescentus CB15

Site:
position = -128
score = 8.40483
sequence = ATACTTGACCGCCGCGCTTGGTCTT

Gene: CC1866: Iron-sulfur cluster regulator IscR
*
Caulobacter segnis ATCC 21756

Site:
position = -127
score = 8.40483
sequence = ATACTTGACCGCCGCGCTTGGTCTT

Gene: Cseg_2153: Iron-sulfur cluster regulator IscR
*
Caulobacter sp. K31

Site:
position = -137
score = 8.40483
sequence = ATACTTGACCGCTGCGCTTGGTCTT

Gene: Caul_2586: Iron-sulfur cluster regulator IscR
*
Phenylobacterium zucineum HLK1

Site:
position = -138
score = 8.07733
sequence = ATACTTGACTGCTGCGCTAGGTCTT

Gene: PHZ_c1722: Iron-sulfur cluster regulator IscR
Iron-sulfur cluster regulator IscR
iscS
 
Caulobacter crescentus CB15

Gene: CC1865: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Caulobacter segnis ATCC 21756

Gene: Cseg_2152: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Caulobacter sp. K31

Gene: Caul_2587: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c1721: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
sufB
 
Caulobacter crescentus CB15

Gene: CC1864: Iron-sulfur cluster assembly protein SufB
 
Caulobacter segnis ATCC 21756

Gene: Cseg_2151: Iron-sulfur cluster assembly protein SufB
 
Caulobacter sp. K31

Gene: Caul_2588: Iron-sulfur cluster assembly protein SufB
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c1720: Iron-sulfur cluster assembly protein SufB
Iron-sulfur cluster assembly protein SufB
Caul_2589
 
Caulobacter crescentus CB15
 
Caulobacter segnis ATCC 21756
 
Caulobacter sp. K31

Gene: Caul_2589: Hypothetical protein
 
Phenylobacterium zucineum HLK1
Hypothetical protein
Caul_2590
 
Caulobacter crescentus CB15
 
Caulobacter segnis ATCC 21756
 
Caulobacter sp. K31

Gene: Caul_2590: Hypothetical protein
 
Phenylobacterium zucineum HLK1
Hypothetical protein
sufC
 
Caulobacter crescentus CB15

Gene: CC1862: Iron-sulfur cluster assembly ATPase protein SufC
 
Caulobacter segnis ATCC 21756

Gene: Cseg_2150: Iron-sulfur cluster assembly ATPase protein SufC
 
Caulobacter sp. K31

Gene: Caul_2591: Iron-sulfur cluster assembly ATPase protein SufC
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c1719: Iron-sulfur cluster assembly ATPase protein SufC
Iron-sulfur cluster assembly ATPase protein SufC
sufD
 
Caulobacter crescentus CB15

Gene: CC1861: Iron-sulfur cluster assembly protein SufD
 
Caulobacter segnis ATCC 21756

Gene: Cseg_2149: Iron-sulfur cluster assembly protein SufD
 
Caulobacter sp. K31

Gene: Caul_2592: Iron-sulfur cluster assembly protein SufD
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c1718: Iron-sulfur cluster assembly protein SufD
Iron-sulfur cluster assembly protein SufD
sufS
 
Caulobacter crescentus CB15

Gene: CC1860: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Caulobacter segnis ATCC 21756

Gene: Cseg_2148: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Caulobacter sp. K31

Gene: Caul_2593: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c1717: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
sufT
 
Caulobacter crescentus CB15

Gene: CC1859: Iron sulfur cluster assembly protein SufT
 
Caulobacter segnis ATCC 21756

Gene: Cseg_2147: Iron sulfur cluster assembly protein SufT
 
Caulobacter sp. K31

Gene: Caul_2594: Iron sulfur cluster assembly protein SufT
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c1716: Iron sulfur cluster assembly protein SufT
Iron sulfur cluster assembly protein SufT
sufA
 
Caulobacter crescentus CB15

Gene: CC1858: Iron binding protein SufA for iron-sulfur cluster assembly
 
Caulobacter segnis ATCC 21756

Gene: Cseg_2146: Iron binding protein SufA for iron-sulfur cluster assembly
 
Caulobacter sp. K31

Gene: Caul_2595: Iron binding protein SufA for iron-sulfur cluster assembly
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c1715: Iron binding protein SufA for iron-sulfur cluster assembly
Iron binding protein SufA for iron-sulfur cluster assembly
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD