Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog IscR - Sphingomonadales

Properties
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Erythrobacter litoralis HTCC2594 11 1
Erythrobacter sp. NAP1 10 1
Novosphingobium aromaticivorans DSM 12444 8 1
Sphingopyxis alaskensis RB2256 9 1
Sphingobium japonicum UT26S 9 1
Sphingomonas wittichii RW1 7 1
Zymomonas mobilis subsp. mobilis ZM4 7 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
iscR
*
Erythrobacter litoralis HTCC2594

Site:
position = -40
score = 7.0465
sequence = AAATCGGAACGATTTGGTCCGATTT

Gene: ELI_12790: Iron-sulfur cluster regulator IscR
*
Erythrobacter sp. NAP1

Site:
position = -61
score = 7.05614
sequence = AAATCCGACTGATTCAGTCCGATTT

Gene: NAP1_13233: Iron-sulfur cluster regulator IscR
*
Novosphingobium aromaticivorans DSM 12444

Site:
position = -53
score = 7.07261
sequence = TAACCGGAGTGATTCGGTCCGATTT

Gene: Saro_0194: Iron-sulfur cluster regulator IscR
*
Sphingopyxis alaskensis RB2256

Site:
position = -55
score = 5.61779
sequence = TAAGTGGAGTAATTTACTCTAGTTA

Gene: Sala_0675: Iron-sulfur cluster regulator IscR
*
Sphingobium japonicum UT26S

Site:
position = -51
score = 6.84792
sequence = CAATCGGATGGATTCGATCCGATTT

Gene: SJA_C1-34000: Iron-sulfur cluster regulator IscR
*
Sphingomonas wittichii RW1

Site:
position = -38
score = 6.71651
sequence = CAATCGGATCGAATCAGTCCGATTG

Gene: Swit_2919: Iron-sulfur cluster regulator IscR
*
Zymomonas mobilis subsp. mobilis ZM4

Site:
position = -111
score = 6.22362
sequence = TAATCAGACAAATTTAGTCTTGTTT

Gene: ZMO0422: Iron-sulfur cluster regulator IscR
Iron-sulfur cluster regulator IscR
sufB
 
Erythrobacter litoralis HTCC2594

Gene: ELI_12785: Iron-sulfur cluster assembly protein SufB
 
Erythrobacter sp. NAP1

Gene: NAP1_13238: Iron-sulfur cluster assembly protein SufB
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_0195: Iron-sulfur cluster assembly protein SufB
 
Sphingopyxis alaskensis RB2256

Gene: Sala_0674: Iron-sulfur cluster assembly protein SufB
 
Sphingobium japonicum UT26S

Gene: SJA_C1-33990: Iron-sulfur cluster assembly protein SufB
 
Sphingomonas wittichii RW1

Gene: Swit_2918: Iron-sulfur cluster assembly protein SufB
 
Zymomonas mobilis subsp. mobilis ZM4

Gene: ZMO0423: Iron-sulfur cluster assembly protein SufB
Iron-sulfur cluster assembly protein SufB
ELI_12780
 
Erythrobacter litoralis HTCC2594

Gene: ELI_12780: Hypothetical protein
 
Erythrobacter sp. NAP1
 
Novosphingobium aromaticivorans DSM 12444
 
Sphingopyxis alaskensis RB2256
 
Sphingobium japonicum UT26S
 
Sphingomonas wittichii RW1
 
Zymomonas mobilis subsp. mobilis ZM4
Hypothetical protein
ycjD
 
Erythrobacter litoralis HTCC2594

Gene: ELI_12775: Conserved hypothetical protein
 
Erythrobacter sp. NAP1

Gene: NAP1_13243: Conserved hypothetical protein
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_0196: Conserved hypothetical protein
 2
Sphingopyxis alaskensis RB2256

Gene: Sala_0672: Conserved hypothetical protein

Gene: Sala_0673: Conserved hypothetical protein
 
Sphingobium japonicum UT26S

Gene: SJA_C1-33980: Conserved hypothetical protein
 
Sphingomonas wittichii RW1
 
Zymomonas mobilis subsp. mobilis ZM4
Conserved hypothetical protein
ELI_12770
 
Erythrobacter litoralis HTCC2594

Gene: ELI_12770: Hypothetical protein
 
Erythrobacter sp. NAP1
 
Novosphingobium aromaticivorans DSM 12444
 
Sphingopyxis alaskensis RB2256
 
Sphingobium japonicum UT26S
 
Sphingomonas wittichii RW1
 
Zymomonas mobilis subsp. mobilis ZM4
Hypothetical protein
ELI_12765
 
Erythrobacter litoralis HTCC2594

Gene: ELI_12765: Conserved hypothetical protein
 
Erythrobacter sp. NAP1

Gene: NAP1_13248: Conserved hypothetical protein
 
Novosphingobium aromaticivorans DSM 12444
 
Sphingopyxis alaskensis RB2256
 
Sphingobium japonicum UT26S
 
Sphingomonas wittichii RW1
 
Zymomonas mobilis subsp. mobilis ZM4
Conserved hypothetical protein
sufC
 
Erythrobacter litoralis HTCC2594

Gene: ELI_12760: Iron-sulfur cluster assembly ATPase protein SufC
 
Erythrobacter sp. NAP1

Gene: NAP1_13253: Iron-sulfur cluster assembly ATPase protein SufC
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_0197: Iron-sulfur cluster assembly ATPase protein SufC
 
Sphingopyxis alaskensis RB2256

Gene: Sala_0671: Iron-sulfur cluster assembly ATPase protein SufC
 
Sphingobium japonicum UT26S

Gene: SJA_C1-33960: Iron-sulfur cluster assembly ATPase protein SufC
 
Sphingomonas wittichii RW1

Gene: Swit_2917: Iron-sulfur cluster assembly ATPase protein SufC
 
Zymomonas mobilis subsp. mobilis ZM4

Gene: ZMO0425: Iron-sulfur cluster assembly ATPase protein SufC
Iron-sulfur cluster assembly ATPase protein SufC
sufD
 
Erythrobacter litoralis HTCC2594

Gene: ELI_12755: Iron-sulfur cluster assembly protein SufD
 
Erythrobacter sp. NAP1

Gene: NAP1_13263: Iron-sulfur cluster assembly protein SufD
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_0198: Iron-sulfur cluster assembly protein SufD
 
Sphingopyxis alaskensis RB2256

Gene: Sala_0670: Iron-sulfur cluster assembly protein SufD
 
Sphingobium japonicum UT26S

Gene: SJA_C1-33950: Iron-sulfur cluster assembly protein SufD
 
Sphingomonas wittichii RW1

Gene: Swit_2916: Iron-sulfur cluster assembly protein SufD
 
Zymomonas mobilis subsp. mobilis ZM4

Gene: ZMO0426: Iron-sulfur cluster assembly protein SufD
Iron-sulfur cluster assembly protein SufD
sufS
 
Erythrobacter litoralis HTCC2594

Gene: ELI_12750: Cysteine desulfurases, SufS subfamily
 
Erythrobacter sp. NAP1

Gene: NAP1_13268: Cysteine desulfurases, SufS subfamily
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_0199: Cysteine desulfurases, SufS subfamily
 
Sphingopyxis alaskensis RB2256

Gene: Sala_0669: Cysteine desulfurases, SufS subfamily
 
Sphingobium japonicum UT26S

Gene: SJA_C1-33940: Cysteine desulfurases, SufS subfamily
 
Sphingomonas wittichii RW1

Gene: Swit_2915: Cysteine desulfurases, SufS subfamily
 
Zymomonas mobilis subsp. mobilis ZM4

Gene: ZMO0427: Cysteine desulfurases, SufS subfamily
Cysteine desulfurases, SufS subfamily
sufT
 
Erythrobacter litoralis HTCC2594

Gene: ELI_12745: Iron sulfur cluster assembly protein SufT
 
Erythrobacter sp. NAP1

Gene: NAP1_13273: Iron sulfur cluster assembly protein SufT
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_0200: Iron sulfur cluster assembly protein SufT
 
Sphingopyxis alaskensis RB2256

Gene: Sala_0668: Iron sulfur cluster assembly protein SufT
 
Sphingobium japonicum UT26S

Gene: SJA_C1-33930: Iron sulfur cluster assembly protein SufT
 
Sphingomonas wittichii RW1

Gene: Swit_2914: Iron sulfur cluster assembly protein SufT
 
Zymomonas mobilis subsp. mobilis ZM4

Gene: ZMO0428: Iron sulfur cluster assembly protein SufT
Iron sulfur cluster assembly protein SufT
sufA
 
Erythrobacter litoralis HTCC2594

Gene: ELI_12740: Iron binding protein SufA for iron-sulfur cluster assembly
 
Erythrobacter sp. NAP1

Gene: NAP1_13278: Iron binding protein SufA for iron-sulfur cluster assembly
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_0201: Iron binding protein SufA for iron-sulfur cluster assembly
 
Sphingopyxis alaskensis RB2256

Gene: Sala_0667: Iron binding protein SufA for iron-sulfur cluster assembly
 
Sphingobium japonicum UT26S

Gene: SJA_C1-33920: Iron binding protein SufA for iron-sulfur cluster assembly
 
Sphingomonas wittichii RW1

Gene: Swit_2913: Iron binding protein SufA for iron-sulfur cluster assembly
 
Zymomonas mobilis subsp. mobilis ZM4

Gene: ZMO0429: Iron binding protein SufA for iron-sulfur cluster assembly
Iron binding protein SufA for iron-sulfur cluster assembly
NAP1_13258
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1

Gene: NAP1_13258: Hypothetical protein
 
Novosphingobium aromaticivorans DSM 12444
 
Sphingopyxis alaskensis RB2256
 
Sphingobium japonicum UT26S
 
Sphingomonas wittichii RW1
 
Zymomonas mobilis subsp. mobilis ZM4
Hypothetical protein
SJA_C1-33970
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1
 
Novosphingobium aromaticivorans DSM 12444
 
Sphingopyxis alaskensis RB2256
 
Sphingobium japonicum UT26S

Gene: SJA_C1-33970: Hypothetical protein
 
Sphingomonas wittichii RW1
 
Zymomonas mobilis subsp. mobilis ZM4
Hypothetical protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD