Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog IscR - Rhodospirillales

Properties
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Rhodospirillum rubrum ATCC 11170 4 1
Magnetospirillum magnetotacticum MS-1 1 1
Magnetospirillum magneticum AMB-1 10 1
Azospirillum sp. B510 5 1
Rhodospirillum centenum SW 4 1
Gluconacetobacter diazotrophicus PAl 5
Acetobacter pasteurianus IFO 3283-01
Gluconobacter oxydans 621H
Granulibacter bethesdensis CGDNIH1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
cysE
*
Rhodospirillum rubrum ATCC 11170

Site:
position = -116
score = 6.96087
sequence = ATTCTTGACCGATTTTCTCGGACAC

Gene: Rru_A2029: Serine acetyltransferase (EC 2.3.1.30)
*
Magnetospirillum magnetotacticum MS-1

Site:
position = -193
score = 7.17465
sequence = AATCTTGACTGGCCTTGTCGGGCAT

Gene: Magn03007535: Serine acetyltransferase (EC 2.3.1.30)
*
Magnetospirillum magneticum AMB-1

Site:
position = -117
score = 7.27612
sequence = AATCTTGACTGGCCTTGTCGGACAT

Gene: amb3031: Serine acetyltransferase (EC 2.3.1.30)
*2
Azospirillum sp. B510

Gene: AZL_006530: Serine acetyltransferase (EC 2.3.1.30)

Site:
position = -200
score = 7.04525
sequence = ATTCTTGACCGTTTTGCTTGGTCAT

Gene: AZL_020070: Serine acetyltransferase (EC 2.3.1.30)
*
Rhodospirillum centenum SW

Site:
position = -129
score = 6.64562
sequence = ATACTTGACCATACTGGTAGGTCAT

Gene: RC1_1619: Serine acetyltransferase (EC 2.3.1.30)
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
Serine acetyltransferase (EC 2.3.1.30)
iscR
 
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A2028: Iron-sulfur cluster regulator IscR
 
Magnetospirillum magnetotacticum MS-1

Gene: Magn03007504: Iron-sulfur cluster regulator IscR
 
Magnetospirillum magneticum AMB-1

Gene: amb3030: Iron-sulfur cluster regulator IscR
 
Azospirillum sp. B510

Gene: AZL_020080: Iron-sulfur cluster regulator IscR
 
Rhodospirillum centenum SW

Gene: RC1_1618: Iron-sulfur cluster regulator IscR
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
Iron-sulfur cluster regulator IscR
iscS2
 
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A2027: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 2
Magnetospirillum magnetotacticum MS-1

Gene: Magn03007506: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily

Gene: Magn03007505: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Magnetospirillum magneticum AMB-1

Gene: amb3029: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Azospirillum sp. B510

Gene: AZL_020090: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Rhodospirillum centenum SW

Gene: RC1_1616: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Gluconacetobacter diazotrophicus PAl 5

Gene: Gdia_0617: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Acetobacter pasteurianus IFO 3283-01

Gene: APA01_26020: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Gluconobacter oxydans 621H

Gene: GOX1368: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Granulibacter bethesdensis CGDNIH1

Gene: GbCGDNIH1_1944: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
iscS
 
Rhodospirillum rubrum ATCC 11170
 
Magnetospirillum magnetotacticum MS-1

Gene: Magn03007507: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Magnetospirillum magneticum AMB-1

Gene: amb3028: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Azospirillum sp. B510
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5

Gene: Gdia_0616: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Acetobacter pasteurianus IFO 3283-01

Gene: APA01_26010: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Gluconobacter oxydans 621H

Gene: GOX1369: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Granulibacter bethesdensis CGDNIH1

Gene: GbCGDNIH1_1943: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
iscU
 
Rhodospirillum rubrum ATCC 11170
 
Magnetospirillum magnetotacticum MS-1

Gene: Magn03007508: Iron-sulfur cluster assembly scaffold protein IscU
 
Magnetospirillum magneticum AMB-1

Gene: amb3027: Iron-sulfur cluster assembly scaffold protein IscU
 
Azospirillum sp. B510
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
Iron-sulfur cluster assembly scaffold protein IscU
iscA
 
Rhodospirillum rubrum ATCC 11170
 
Magnetospirillum magnetotacticum MS-1

Gene: Magn03007509: Iron binding protein IscA for iron-sulfur cluster assembly
 
Magnetospirillum magneticum AMB-1

Gene: amb3026: Iron binding protein IscA for iron-sulfur cluster assembly
 
Azospirillum sp. B510
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
Iron binding protein IscA for iron-sulfur cluster assembly
hscB
 
Rhodospirillum rubrum ATCC 11170
 
Magnetospirillum magnetotacticum MS-1

Gene: Magn03007510: Chaperone protein HscB
 
Magnetospirillum magneticum AMB-1

Gene: amb3025: Chaperone protein HscB
 
Azospirillum sp. B510

Gene: AZL_020100: Chaperone protein HscB
 
Rhodospirillum centenum SW

Gene: RC1_1615: Chaperone protein HscB
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
Chaperone protein HscB
hscA
 
Rhodospirillum rubrum ATCC 11170
 
Magnetospirillum magnetotacticum MS-1

Gene: Magn03007511: Chaperone protein HscA
 
Magnetospirillum magneticum AMB-1

Gene: amb3024: Chaperone protein HscA
 
Azospirillum sp. B510
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
Chaperone protein HscA
fdx
 
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A2026: ferredoxin, 2Fe-2S type, ISC system
 
Magnetospirillum magnetotacticum MS-1

Gene: Magn03007592: ferredoxin, 2Fe-2S type, ISC system
 
Magnetospirillum magneticum AMB-1

Gene: amb3023: ferredoxin, 2Fe-2S type, ISC system
 
Azospirillum sp. B510

Gene: AZL_020110: ferredoxin, 2Fe-2S type, ISC system
 
Rhodospirillum centenum SW

Gene: RC1_1614: ferredoxin, 2Fe-2S type, ISC system
 
Gluconacetobacter diazotrophicus PAl 5

Gene: Gdia_0615: ferredoxin, 2Fe-2S type, ISC system
 
Acetobacter pasteurianus IFO 3283-01

Gene: APA01_26000: ferredoxin, 2Fe-2S type, ISC system
 
Gluconobacter oxydans 621H

Gene: GOX1370: ferredoxin, 2Fe-2S type, ISC system
 
Granulibacter bethesdensis CGDNIH1

Gene: GbCGDNIH1_1942: ferredoxin, 2Fe-2S type, ISC system
ferredoxin, 2Fe-2S type, ISC system
yfhJ
 
Rhodospirillum rubrum ATCC 11170
 
Magnetospirillum magnetotacticum MS-1

Gene: Magn03007591: putative Fe-S cluster assembly protein
 
Magnetospirillum magneticum AMB-1

Gene: amb3022: putative Fe-S cluster assembly protein
 
Azospirillum sp. B510
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
putative Fe-S cluster assembly protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD