Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog IscR - Various betaproteobacteria

Properties
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 27 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Azoarcus sp. EbN1 11 3
Thauera sp. MZ1T 10 2
Dechloromonas aromatica RCB 10 2
Nitrosomonas europaea ATCC 19718 8 1
Nitrosospira multiformis ATCC 25196 10 2
Thiobacillus denitrificans 10 3
Chromobacterium violaceum ATCC 12472 9 1
Neisseria meningitidis MC58 2 1
Laribacter hongkongensis HLHK9 9 1
Methylobacillus flagellatus KT 9 2
Methylotenera mobilis JLW8 3 1
Methylophilales bacterium HTCC2181 9 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
cysE
*
Azoarcus sp. EbN1

Site:
position = -62
score = 5.82695
sequence = AAACCCGACTAAACTAGTCGGGAAT

Gene: ebA6405: Serine acetyltransferase (EC 2.3.1.30)
*
Thauera sp. MZ1T

Site:
position = -95
score = 6.14886
sequence = ATAGTCGATTAAAATTCTCGGGAAT

Gene: Tmz1t_2208: Serine acetyltransferase (EC 2.3.1.30)
*
Dechloromonas aromatica RCB

Site:
position = -64
score = 6.14278
sequence = ATAGCTGACAAATTCAGTCGAGTAT

Gene: Daro_1947: Serine acetyltransferase (EC 2.3.1.30)
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
*
Thiobacillus denitrificans

Site:
position = -39
score = 6.53626
sequence = ATAGTTGACTAAAATACTCGGAAAT

Gene: Tbd_1162: Serine acetyltransferase (EC 2.3.1.30)
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
*
Methylobacillus flagellatus KT

Site:
position = -21
score = 4.55075
sequence = ATTTCAGAGTAAAATAGTCGGATGT

Gene: Mfla_0811: Serine acetyltransferase (EC 2.3.1.30)
 
Methylotenera mobilis JLW8

Gene: Mmol_1670: Serine acetyltransferase (EC 2.3.1.30)
*
Methylophilales bacterium HTCC2181

Site:
position = -84
score = 5.96804
sequence = ATACTTGAGTTATTTACTCAGGATT

Gene: MB2181_02935: Serine acetyltransferase (EC 2.3.1.30)
Serine acetyltransferase (EC 2.3.1.30)
 
CRON 2.
ydhD
*
Azoarcus sp. EbN1

Site:
position = -39
score = 5.24922
sequence = TTACCCGACTGAAACACTCAACTTT

Gene: ebA1175: Probable monothiol glutaredoxin ydhD
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718

Gene: NE1911: Probable monothiol glutaredoxin ydhD
 
Nitrosospira multiformis ATCC 25196

Gene: Nmul_A2639: Probable monothiol glutaredoxin ydhD
*
Thiobacillus denitrificans

Site:
position = -38
score = 5.10973
sequence = ATTCCCGAGTATTCCACTCAGGTAT

Gene: Tbd_2499: Probable monothiol glutaredoxin ydhD
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Probable monothiol glutaredoxin ydhD
 
CRON 3.
iscR
*
Azoarcus sp. EbN1

Site:
position = -91
score = 5.56115
sequence = GTAGTTGACCGATTTTGTCGGGTTA

Site:
position = -63
score = 5.84801
sequence = ATAGTCGAGTGAAACGTTCGGGTAT

Gene: ebA6404: Iron-sulfur cluster regulator IscR
*
Thauera sp. MZ1T

Site:
position = -75
score = 5.58039
sequence = ATACTCGACAAAAATGATGGGATAT

Site:
position = -103
score = 5.12715
sequence = TTAGTTGACCGTTTTTGTCGGGATC

Gene: Tmz1t_2207: Iron-sulfur cluster regulator IscR
*
Dechloromonas aromatica RCB

Site:
position = -69
score = 6.25007
sequence = ATAGTTGACTAATTTTCTCTGGTTT

Site:
position = -40
score = 5.46512
sequence = ATAGTTGACCTTAATACTAGGTTAT

Site:
position = -82
score = 5.1747
sequence = ATACCTGAGCAAAATAGTTGACTAA

Gene: Daro_1948: Iron-sulfur cluster regulator IscR
*
Nitrosomonas europaea ATCC 19718

Site:
position = -100
score = 6.71766
sequence = ATAGTTGACTAATATTGTCGGGTAT

Gene: NE1452: Iron-sulfur cluster regulator IscR
*2
Nitrosospira multiformis ATCC 25196

Site:
position = -225
score = 5.84844
sequence = ATACTTGATCAATGTTGTCGGGTAT

Gene: Nmul_A0674: Iron-sulfur cluster regulator IscR

Site:
position = -103
score = 6.12231
sequence = ATAGTTGACTAAATCAGTCATCTAT

Site:
position = -131
score = 6.48735
sequence = ATAGTTGACTAAATCAATCAGGTAT

Gene: Nmul_A0694: Iron-sulfur cluster regulator IscR
*
Thiobacillus denitrificans

Site:
position = -88
score = 6.17141
sequence = ATAGTTGACTAAATTGCTAAGGTAA

Site:
position = -60
score = 6.48102
sequence = ATAGTTGACTGAAATGCTCGGGAAT

Gene: Tbd_1163: Iron-sulfur cluster regulator IscR
*
Chromobacterium violaceum ATCC 12472

Site:
position = -71
score = 6.60071
sequence = ATACTTGACTAATTTAGTCGGATAT

Gene: CV1095: Iron-sulfur cluster regulator IscR
*
Neisseria meningitidis MC58

Site:
position = -74
score = 6.26978
sequence = ATACTTGACTGAAACACTCAGATAT

Gene: NMB1378: Iron-sulfur cluster regulator IscR
*
Laribacter hongkongensis HLHK9

Site:
position = -63
score = 6.39685
sequence = ATGGTTGACTAAATTAGTCGGGTTT

Gene: LHK_02866: Iron-sulfur cluster regulator IscR
*
Methylobacillus flagellatus KT

Site:
position = -111
score = 6.32029
sequence = ATAGTTGACTAAAGTATTCAGGTAT

Gene: Mfla_0810: Iron-sulfur cluster regulator IscR
*
Methylotenera mobilis JLW8

Site:
position = -70
score = 6.33884
sequence = ATAGTTGACTAAAATTGTAAGGAAT

Gene: Mmol_1671: Iron-sulfur cluster regulator IscR
*
Methylophilales bacterium HTCC2181

Site:
position = -58
score = 5.64876
sequence = ATACTTGATAGTTTTAGTCAAGTAT

Gene: MB2181_02930: Iron-sulfur cluster regulator IscR
Iron-sulfur cluster regulator IscR
iscS1
 
Azoarcus sp. EbN1

Gene: ebA6402: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Thauera sp. MZ1T

Gene: Tmz1t_2206: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Dechloromonas aromatica RCB

Gene: Daro_1949: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196

Gene: Nmul_A0675: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT

Gene: Mfla_0809: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Methylotenera mobilis JLW8

Gene: Mmol_1672: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Methylophilales bacterium HTCC2181

Gene: MB2181_02925: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
iscS2
 
Azoarcus sp. EbN1

Gene: ebA6401: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Thauera sp. MZ1T

Gene: Tmz1t_2205: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Dechloromonas aromatica RCB

Gene: Daro_1950: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans

Gene: Tbd_1164: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Chromobacterium violaceum ATCC 12472

Gene: CV1094: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Neisseria meningitidis MC58

Gene: NMB1379: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Laribacter hongkongensis HLHK9

Gene: LHK_02865: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Methylobacillus flagellatus KT

Gene: Mfla_0808: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Methylotenera mobilis JLW8

Gene: Mmol_1673: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Methylophilales bacterium HTCC2181

Gene: MB2181_02920: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
iscU
 
Azoarcus sp. EbN1

Gene: ebA6400: Iron-sulfur cluster assembly scaffold protein IscU
 
Thauera sp. MZ1T

Gene: Tmz1t_2204: Iron-sulfur cluster assembly scaffold protein IscU
 
Dechloromonas aromatica RCB

Gene: Daro_1951: Iron-sulfur cluster assembly scaffold protein IscU
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans

Gene: Tbd_1165: Iron-sulfur cluster assembly scaffold protein IscU
 
Chromobacterium violaceum ATCC 12472

Gene: CV1093: Iron-sulfur cluster assembly scaffold protein IscU
 
Neisseria meningitidis MC58

Gene: NMB1380: Iron-sulfur cluster assembly scaffold protein IscU
 
Laribacter hongkongensis HLHK9

Gene: LHK_02864: Iron-sulfur cluster assembly scaffold protein IscU
 
Methylobacillus flagellatus KT

Gene: Mfla_0807: Iron-sulfur cluster assembly scaffold protein IscU
 
Methylotenera mobilis JLW8

Gene: Mmol_1674: Iron-sulfur cluster assembly scaffold protein IscU
 
Methylophilales bacterium HTCC2181

Gene: MB2181_02915: Iron-sulfur cluster assembly scaffold protein IscU
Iron-sulfur cluster assembly scaffold protein IscU
iscA
 
Azoarcus sp. EbN1

Gene: ebB230: Iron binding protein IscA for iron-sulfur cluster assembly
 
Thauera sp. MZ1T

Gene: Tmz1t_2203: Iron binding protein IscA for iron-sulfur cluster assembly
 
Dechloromonas aromatica RCB

Gene: Daro_1952: Iron binding protein IscA for iron-sulfur cluster assembly
 
Nitrosomonas europaea ATCC 19718

Gene: NE1451: Iron binding protein IscA for iron-sulfur cluster assembly
 
Nitrosospira multiformis ATCC 25196

Gene: Nmul_A0695: Iron binding protein IscA for iron-sulfur cluster assembly
 
Thiobacillus denitrificans

Gene: Tbd_1166: Iron binding protein IscA for iron-sulfur cluster assembly
 
Chromobacterium violaceum ATCC 12472

Gene: CV1092: Iron binding protein IscA for iron-sulfur cluster assembly
 
Neisseria meningitidis MC58

Gene: NMB1381: Iron binding protein IscA for iron-sulfur cluster assembly
 
Laribacter hongkongensis HLHK9

Gene: LHK_02863: Iron binding protein IscA for iron-sulfur cluster assembly
 
Methylobacillus flagellatus KT

Gene: Mfla_0806: Iron binding protein IscA for iron-sulfur cluster assembly
 
Methylotenera mobilis JLW8

Gene: Mmol_1675: Iron binding protein IscA for iron-sulfur cluster assembly
 
Methylophilales bacterium HTCC2181

Gene: MB2181_02910: Iron binding protein IscA for iron-sulfur cluster assembly
Iron binding protein IscA for iron-sulfur cluster assembly
hscB
 
Azoarcus sp. EbN1

Gene: ebA6397: Chaperone protein HscB
 
Thauera sp. MZ1T

Gene: Tmz1t_2202: Chaperone protein HscB
 
Dechloromonas aromatica RCB

Gene: Daro_1953: Chaperone protein HscB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans

Gene: Tbd_1167: Chaperone protein HscB
 
Chromobacterium violaceum ATCC 12472

Gene: CV1091: Chaperone protein HscB
 
Neisseria meningitidis MC58

Gene: NMB1383: Chaperone protein HscB
 
Laribacter hongkongensis HLHK9

Gene: LHK_02862: Chaperone protein HscB
 
Methylobacillus flagellatus KT

Gene: Mfla_0805: Chaperone protein HscB
 
Methylotenera mobilis JLW8

Gene: Mmol_1676: Chaperone protein HscB
 
Methylophilales bacterium HTCC2181

Gene: MB2181_02905: Chaperone protein HscB
Chaperone protein HscB
hscA
 
Azoarcus sp. EbN1

Gene: ebA6396: Chaperone protein HscA
 
Thauera sp. MZ1T

Gene: Tmz1t_2201: Chaperone protein HscA
 
Dechloromonas aromatica RCB

Gene: Daro_1954: Chaperone protein HscA
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans

Gene: Tbd_1168: Chaperone protein HscA
 
Chromobacterium violaceum ATCC 12472

Gene: CV1089: Chaperone protein HscA
 2
Neisseria meningitidis MC58

Gene: NMB1131: Chaperone protein HscA

Gene: NMB1169: Chaperone protein HscA
 
Laribacter hongkongensis HLHK9

Gene: LHK_02861: Chaperone protein HscA
 
Methylobacillus flagellatus KT

Gene: Mfla_0804: Chaperone protein HscA
 
Methylotenera mobilis JLW8

Gene: Mmol_1677: Chaperone protein HscA
 
Methylophilales bacterium HTCC2181

Gene: MB2181_02900: Chaperone protein HscA
Chaperone protein HscA
fdx
 
Azoarcus sp. EbN1

Gene: ebB229: ferredoxin, 2Fe-2S type, ISC system
 
Thauera sp. MZ1T

Gene: Tmz1t_2200: ferredoxin, 2Fe-2S type, ISC system
 
Dechloromonas aromatica RCB

Gene: Daro_1955: ferredoxin, 2Fe-2S type, ISC system
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans

Gene: Tbd_1169: ferredoxin, 2Fe-2S type, ISC system
 
Chromobacterium violaceum ATCC 12472

Gene: CV1088: ferredoxin, 2Fe-2S type, ISC system
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9

Gene: LHK_02860: ferredoxin, 2Fe-2S type, ISC system
 
Methylobacillus flagellatus KT

Gene: Mfla_0803: ferredoxin, 2Fe-2S type, ISC system
 
Methylotenera mobilis JLW8

Gene: Mmol_1678: ferredoxin, 2Fe-2S type, ISC system
 
Methylophilales bacterium HTCC2181

Gene: MB2181_02895: ferredoxin, 2Fe-2S type, ISC system
ferredoxin, 2Fe-2S type, ISC system
yfhJ
 
Azoarcus sp. EbN1

Gene: ebA6395: putative Fe-S cluster assembly protein
 
Thauera sp. MZ1T

Gene: Tmz1t_2199: putative Fe-S cluster assembly protein
 
Dechloromonas aromatica RCB

Gene: Daro_1956: putative Fe-S cluster assembly protein
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans

Gene: Tbd_1170: putative Fe-S cluster assembly protein
 
Chromobacterium violaceum ATCC 12472

Gene: CV1087: putative Fe-S cluster assembly protein
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9

Gene: LHK_02858: putative Fe-S cluster assembly protein
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8

Gene: Mmol_1560: putative Fe-S cluster assembly protein
 
Methylophilales bacterium HTCC2181

Gene: MB2181_05240: putative Fe-S cluster assembly protein
putative Fe-S cluster assembly protein
CV1911
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9

Gene: LHK_02859: YbaK/prolyl-tRNA synthetase associated region
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
YbaK family protein
CV1090
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472

Gene: CV1090: hypothetical protein
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
hypothetical protein
sufB
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T

Gene: Tmz1t_1899: Iron-sulfur cluster assembly protein SufB
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718

Gene: NE1450: Iron-sulfur cluster assembly protein SufB
 
Nitrosospira multiformis ATCC 25196

Gene: Nmul_A0696: Iron-sulfur cluster assembly protein SufB
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8

Gene: Mmol_1129: Iron-sulfur cluster assembly protein SufB
 
Methylophilales bacterium HTCC2181
Iron-sulfur cluster assembly protein SufB
sufC
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T

Gene: Tmz1t_1898: Iron-sulfur cluster assembly ATPase protein SufC
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718

Gene: NE1449: Iron-sulfur cluster assembly ATPase protein SufC
 
Nitrosospira multiformis ATCC 25196

Gene: Nmul_A0697: Iron-sulfur cluster assembly ATPase protein SufC
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8

Gene: Mmol_1128: Iron-sulfur cluster assembly ATPase protein SufC
 
Methylophilales bacterium HTCC2181
Iron-sulfur cluster assembly ATPase protein SufC
sufD
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T

Gene: Tmz1t_1897: Iron-sulfur cluster assembly protein SufD
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718

Gene: NE1448: Iron-sulfur cluster assembly protein SufD
 
Nitrosospira multiformis ATCC 25196

Gene: Nmul_A0698: Iron-sulfur cluster assembly protein SufD
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8

Gene: Mmol_1127: Iron-sulfur cluster assembly protein SufD
 
Methylophilales bacterium HTCC2181
Iron-sulfur cluster assembly protein SufD
sufS
 
Azoarcus sp. EbN1

Gene: ebA6367: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Thauera sp. MZ1T

Gene: Tmz1t_1896: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Dechloromonas aromatica RCB

Gene: Daro_2137: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Nitrosomonas europaea ATCC 19718

Gene: NE1447: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Nitrosospira multiformis ATCC 25196

Gene: Nmul_A0699: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8

Gene: Mmol_1126: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Methylophilales bacterium HTCC2181
Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
sufE2
 
Azoarcus sp. EbN1

Gene: ebD53: Sulfur acceptor protein SufE for iron-sulfur cluster assembly
 
Thauera sp. MZ1T

Gene: Tmz1t_1895: Sulfur acceptor protein SufE for iron-sulfur cluster assembly
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718

Gene: NE1446: Sulfur acceptor protein SufE for iron-sulfur cluster assembly
 
Nitrosospira multiformis ATCC 25196

Gene: Nmul_A0700: Sulfur acceptor protein SufE for iron-sulfur cluster assembly
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8

Gene: Mmol_1125: Sulfur acceptor protein SufE for iron-sulfur cluster assembly
 
Methylophilales bacterium HTCC2181
Sulfur acceptor protein SufE for iron-sulfur cluster assembly
sufE3
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T

Gene: Tmz1t_2988: Sulfur acceptor protein SufE for iron-sulfur cluster assembly
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718

Gene: NE1445: Sulfur acceptor protein SufE for iron-sulfur cluster assembly
 
Nitrosospira multiformis ATCC 25196

Gene: Nmul_A0701: Sulfur acceptor protein SufE for iron-sulfur cluster assembly
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Sulfur acceptor protein SufE for iron-sulfur cluster assembly
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD