Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog IscR - Comamonadaceae

Properties
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acidovorax avenae subsp. citrulli AAC00-1 7 1
Acidovorax sp. JS42 7 1
Comamonas testosteroni KF-1 7 1
Delftia acidovorans SPH-1 7 1
Polaromonas naphthalenivorans CJ2 7 1
Polaromonas sp. JS666 7 1
Rhodoferax ferrireducens DSM 15236 7 1
Variovorax paradoxus S110 7 1
Verminephrobacter eiseniae EF01-2 7 1
Methylibium petroleiphilum PM1 7 1
Leptothrix cholodnii SP-6 7 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
iscR
*
Acidovorax avenae subsp. citrulli AAC00-1

Site:
position = -207
score = 5.71904
sequence = TTACCCGACAAAAACAATAGGGTTT

Site:
position = -176
score = 5.42735
sequence = ATACTTGGGCGCAACACTCAAGAAA

Gene: Aave_2442: Iron-sulfur cluster regulator IscR
*
Acidovorax sp. JS42

Site:
position = -189
score = 5.64608
sequence = TTACCCGATAAAATTAATAGGGATT

Site:
position = -158
score = 5.83281
sequence = ATACTTGTCTCAAATACTCAAGAAA

Gene: Ajs_2145: Iron-sulfur cluster regulator IscR
*
Comamonas testosteroni KF-1

Site:
position = -182
score = 5.75193
sequence = TTACCCGACAAAATTGATGGGGAAT

Site:
position = -152
score = 5.62556
sequence = ATACTCGCGTCAAACACTCAACAAC

Gene: CtesDRAFT_1260: Iron-sulfur cluster regulator IscR
*
Delftia acidovorans SPH-1

Site:
position = -192
score = 5.75193
sequence = TTACCCGACAAAATTGATGGGGAAT

Gene: Daci_4000: Iron-sulfur cluster regulator IscR
*
Polaromonas naphthalenivorans CJ2

Site:
position = -152
score = 6.26727
sequence = ATACTTGACGAAATTAGTCAAGAAC

Gene: Pnap_2291: Iron-sulfur cluster regulator IscR
*
Polaromonas sp. JS666

Site:
position = -154
score = 6.28806
sequence = ATACTTGACGAAAACAGTCAGGAAC

Gene: Bpro_2177: Iron-sulfur cluster regulator IscR
*
Rhodoferax ferrireducens DSM 15236

Site:
position = -52
score = 5.5616
sequence = ATACTCAACTATATTAGTCAAGTAA

Site:
position = -82
score = 5.24473
sequence = TTACCCGAGTAAATTACTTGGTTTC

Gene: Rfer_2176: Iron-sulfur cluster regulator IscR
*
Variovorax paradoxus S110

Site:
position = -165
score = 5.85685
sequence = ATACTTGAGCGAAATACTCAACAAC

Site:
position = -152
score = 5.41072
sequence = ATACTCAACAACAACAAAAAAGAAC

Gene: Vapar_2141: Iron-sulfur cluster regulator IscR
*
Verminephrobacter eiseniae EF01-2

Site:
position = -216
score = 4.21891
sequence = TAATCCGACAAATTTGATAAGGATT

Gene: Veis_2372: Iron-sulfur cluster regulator IscR
*
Methylibium petroleiphilum PM1

Site:
position = -98
score = 5.10354
sequence = ATAATTGAGCTATTCAGTCGGGATT

Gene: Mpe_A2263: Iron-sulfur cluster regulator IscR
*
Leptothrix cholodnii SP-6

Site:
position = -109
score = 6.13658
sequence = ATAATCGAGTAAAACACTCGGGAAA

Gene: Lcho_1048: Iron-sulfur cluster regulator IscR
Iron-sulfur cluster regulator IscR
iscS
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2443: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Acidovorax sp. JS42

Gene: Ajs_2144: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_1261: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Delftia acidovorans SPH-1

Gene: Daci_3999: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_2290: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Polaromonas sp. JS666

Gene: Bpro_2178: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_2177: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Variovorax paradoxus S110

Gene: Vapar_2142: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_2373: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Methylibium petroleiphilum PM1

Gene: Mpe_A2262: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Leptothrix cholodnii SP-6

Gene: Lcho_1047: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
iscU
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2444: Iron-sulfur cluster assembly scaffold protein IscU
 
Acidovorax sp. JS42

Gene: Ajs_2143: Iron-sulfur cluster assembly scaffold protein IscU
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_1262: Iron-sulfur cluster assembly scaffold protein IscU
 
Delftia acidovorans SPH-1

Gene: Daci_3998: Iron-sulfur cluster assembly scaffold protein IscU
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_2289: Iron-sulfur cluster assembly scaffold protein IscU
 
Polaromonas sp. JS666

Gene: Bpro_2179: Iron-sulfur cluster assembly scaffold protein IscU
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_2178: Iron-sulfur cluster assembly scaffold protein IscU
 
Variovorax paradoxus S110

Gene: Vapar_2143: Iron-sulfur cluster assembly scaffold protein IscU
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_2374: Iron-sulfur cluster assembly scaffold protein IscU
 
Methylibium petroleiphilum PM1

Gene: Mpe_A2261: Iron-sulfur cluster assembly scaffold protein IscU
 
Leptothrix cholodnii SP-6

Gene: Lcho_1046: Iron-sulfur cluster assembly scaffold protein IscU
Iron-sulfur cluster assembly scaffold protein IscU
iscA
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2445: Iron binding protein IscA for iron-sulfur cluster assembly
 
Acidovorax sp. JS42

Gene: Ajs_2142: Iron binding protein IscA for iron-sulfur cluster assembly
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_1263: Iron binding protein IscA for iron-sulfur cluster assembly
 
Delftia acidovorans SPH-1

Gene: Daci_3997: Iron binding protein IscA for iron-sulfur cluster assembly
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_2288: Iron binding protein IscA for iron-sulfur cluster assembly
 
Polaromonas sp. JS666

Gene: Bpro_2180: Iron binding protein IscA for iron-sulfur cluster assembly
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_2179: Iron binding protein IscA for iron-sulfur cluster assembly
 
Variovorax paradoxus S110

Gene: Vapar_2144: Iron binding protein IscA for iron-sulfur cluster assembly
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_2375: Iron binding protein IscA for iron-sulfur cluster assembly
 
Methylibium petroleiphilum PM1

Gene: Mpe_A2260: Iron binding protein IscA for iron-sulfur cluster assembly
 
Leptothrix cholodnii SP-6

Gene: Lcho_1045: Iron binding protein IscA for iron-sulfur cluster assembly
Iron binding protein IscA for iron-sulfur cluster assembly
hscB
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2446: Chaperone protein HscB
 
Acidovorax sp. JS42

Gene: Ajs_2141: Chaperone protein HscB
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_1264: Chaperone protein HscB
 
Delftia acidovorans SPH-1

Gene: Daci_3996: Chaperone protein HscB
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_2287: Chaperone protein HscB
 
Polaromonas sp. JS666

Gene: Bpro_2181: Chaperone protein HscB
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_2180: Chaperone protein HscB
 
Variovorax paradoxus S110

Gene: Vapar_2145: Chaperone protein HscB
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_2376: Chaperone protein HscB
 
Methylibium petroleiphilum PM1

Gene: Mpe_A2259: Chaperone protein HscB
 
Leptothrix cholodnii SP-6

Gene: Lcho_1044: Chaperone protein HscB
Chaperone protein HscB
hscA
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2447: Chaperone protein HscA
 
Acidovorax sp. JS42

Gene: Ajs_2140: Chaperone protein HscA
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_1265: Chaperone protein HscA
 
Delftia acidovorans SPH-1

Gene: Daci_3995: Chaperone protein HscA
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_2286: Chaperone protein HscA
 
Polaromonas sp. JS666

Gene: Bpro_2182: Chaperone protein HscA
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_2181: Chaperone protein HscA
 
Variovorax paradoxus S110

Gene: Vapar_2146: Chaperone protein HscA
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_2377: Chaperone protein HscA
 
Methylibium petroleiphilum PM1

Gene: Mpe_A2258: Chaperone protein HscA
 
Leptothrix cholodnii SP-6

Gene: Lcho_1043: Chaperone protein HscA
Chaperone protein HscA
fdx
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2448: ferredoxin, 2Fe-2S type, ISC system
 
Acidovorax sp. JS42

Gene: Ajs_2139: ferredoxin, 2Fe-2S type, ISC system
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_1266: ferredoxin, 2Fe-2S type, ISC system
 
Delftia acidovorans SPH-1

Gene: Daci_3994: ferredoxin, 2Fe-2S type, ISC system
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_2285: ferredoxin, 2Fe-2S type, ISC system
 
Polaromonas sp. JS666

Gene: Bpro_2183: ferredoxin, 2Fe-2S type, ISC system
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_2182: ferredoxin, 2Fe-2S type, ISC system
 
Variovorax paradoxus S110

Gene: Vapar_2147: ferredoxin, 2Fe-2S type, ISC system
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_2378: ferredoxin, 2Fe-2S type, ISC system
 
Methylibium petroleiphilum PM1

Gene: Mpe_A2257: ferredoxin, 2Fe-2S type, ISC system
 
Leptothrix cholodnii SP-6

Gene: Lcho_1042: ferredoxin, 2Fe-2S type, ISC system
ferredoxin, 2Fe-2S type, ISC system
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD