Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog IscR - Burkholderia

Properties
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Burkholderia pseudomallei K96243 8 1
Burkholderia mallei ATCC 23344 8 1
Burkholderia sp. 383 8 1
Burkholderia cepacia AMMD 8 1
Burkholderia vietnamiensis G4 8 1
Burkholderia glumae BGR1 8 1
Burkholderia xenovorans LB400 8 1
Burkholderia phymatum STM815 8 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
iscR
*
Burkholderia pseudomallei K96243

Site:
position = -69
score = 7.46253
sequence = ATACTTGACTAAATTGGTCAAATAT

Site:
position = -42
score = 7.79991
sequence = ATACTTGACCAAAATCGTCAAGATT

Gene: BPSL2290: Iron-sulfur cluster regulator IscR
*
Burkholderia mallei ATCC 23344

Site:
position = -69
score = 7.46253
sequence = ATACTTGACTAAATTGGTCAAATAT

Site:
position = -42
score = 7.70824
sequence = ATACTTGACAAAAATCGTCAAGATT

Gene: BMA1709: Iron-sulfur cluster regulator IscR
*
Burkholderia sp. 383

Site:
position = -69
score = 7.80515
sequence = ATACTTGACTAAAATCGTCAAATAT

Site:
position = -42
score = 7.79991
sequence = ATACTTGACCAAAATCGTCAAGATT

Gene: Bcep18194_A5433: Iron-sulfur cluster regulator IscR
*
Burkholderia cepacia AMMD

Site:
position = -42
score = 7.79991
sequence = ATACTTGACCAAAATCGTCAAGATT

Site:
position = -69
score = 7.80515
sequence = ATACTTGACTAAAATCGTCAAATAT

Gene: Bamb_2164: Iron-sulfur cluster regulator IscR
*
Burkholderia vietnamiensis G4

Site:
position = -42
score = 7.79991
sequence = ATACTTGACCAAAATCGTCAAGATT

Site:
position = -69
score = 7.51728
sequence = ATACTTGACTAAAAACGTCAAATAT

Gene: Bcep1808_2206: Iron-sulfur cluster regulator IscR
*
Burkholderia glumae BGR1

Site:
position = -68
score = 6.87077
sequence = ATACTTGACTAAAAATGTCAGATAT

Site:
position = -41
score = 7.79991
sequence = ATACTTGACCAAAATCGTCAAGATT

Gene: bglu_1g24710: Iron-sulfur cluster regulator IscR
*
Burkholderia xenovorans LB400

Site:
position = -68
score = 6.95083
sequence = ATACTTGACTAAATCGGTCATGTAT

Site:
position = -41
score = 7.2371
sequence = ATACTTGACAAAACTTGTCGAGAAT

Gene: Bxe_A1552: Iron-sulfur cluster regulator IscR
*
Burkholderia phymatum STM815

Site:
position = -42
score = 7.32877
sequence = ATACTTGACCAAACTTGTCGAGAAT

Site:
position = -69
score = 7.12214
sequence = ATACTTGACTAAATCCGTCATGTAT

Gene: Bphy_1459: Iron-sulfur cluster regulator IscR
Iron-sulfur cluster regulator IscR
iscS
 
Burkholderia pseudomallei K96243

Gene: BPSL2289: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Burkholderia mallei ATCC 23344

Gene: BMA1708: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Burkholderia sp. 383

Gene: Bcep18194_A5432: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Burkholderia cepacia AMMD

Gene: Bamb_2163: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_2205: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Burkholderia glumae BGR1

Gene: bglu_1g24700: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Burkholderia xenovorans LB400

Gene: Bxe_A1553: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Burkholderia phymatum STM815

Gene: Bphy_1458: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
iscU
 
Burkholderia pseudomallei K96243

Gene: BPSL2288: Iron-sulfur cluster assembly scaffold protein IscU
 
Burkholderia mallei ATCC 23344

Gene: BMA1707: Iron-sulfur cluster assembly scaffold protein IscU
 
Burkholderia sp. 383

Gene: Bcep18194_A5431: Iron-sulfur cluster assembly scaffold protein IscU
 
Burkholderia cepacia AMMD

Gene: Bamb_2162: Iron-sulfur cluster assembly scaffold protein IscU
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_2204: Iron-sulfur cluster assembly scaffold protein IscU
 
Burkholderia glumae BGR1

Gene: bglu_1g24690: Iron-sulfur cluster assembly scaffold protein IscU
 
Burkholderia xenovorans LB400

Gene: Bxe_A1554: Iron-sulfur cluster assembly scaffold protein IscU
 
Burkholderia phymatum STM815

Gene: Bphy_1457: Iron-sulfur cluster assembly scaffold protein IscU
Iron-sulfur cluster assembly scaffold protein IscU
iscA
 
Burkholderia pseudomallei K96243

Gene: BPSL2287: Iron binding protein IscA for iron-sulfur cluster assembly
 
Burkholderia mallei ATCC 23344

Gene: BMA1706: Iron binding protein IscA for iron-sulfur cluster assembly
 
Burkholderia sp. 383

Gene: Bcep18194_A5430: Iron binding protein IscA for iron-sulfur cluster assembly
 
Burkholderia cepacia AMMD

Gene: Bamb_2161: Iron binding protein IscA for iron-sulfur cluster assembly
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_2203: Iron binding protein IscA for iron-sulfur cluster assembly
 
Burkholderia glumae BGR1

Gene: bglu_1g24680: Iron binding protein IscA for iron-sulfur cluster assembly
 
Burkholderia xenovorans LB400

Gene: Bxe_A1555: Iron binding protein IscA for iron-sulfur cluster assembly
 
Burkholderia phymatum STM815

Gene: Bphy_1456: Iron binding protein IscA for iron-sulfur cluster assembly
Iron binding protein IscA for iron-sulfur cluster assembly
hscB
 
Burkholderia pseudomallei K96243

Gene: BPSL2286: Chaperone protein HscB
 
Burkholderia mallei ATCC 23344

Gene: BMA1705: Chaperone protein HscB
 
Burkholderia sp. 383

Gene: Bcep18194_A5429: Chaperone protein HscB
 
Burkholderia cepacia AMMD

Gene: Bamb_2160: Chaperone protein HscB
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_2202: Chaperone protein HscB
 
Burkholderia glumae BGR1

Gene: bglu_1g24670: Chaperone protein HscB
 
Burkholderia xenovorans LB400

Gene: Bxe_A1556: Chaperone protein HscB
 
Burkholderia phymatum STM815

Gene: Bphy_1455: Chaperone protein HscB
Chaperone protein HscB
hscA
 
Burkholderia pseudomallei K96243

Gene: BPSL2285: Chaperone protein HscA
 
Burkholderia mallei ATCC 23344

Gene: BMA1704: Chaperone protein HscA
 
Burkholderia sp. 383

Gene: Bcep18194_A5428: Chaperone protein HscA
 
Burkholderia cepacia AMMD

Gene: Bamb_2159: Chaperone protein HscA
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_2201: Chaperone protein HscA
 
Burkholderia glumae BGR1

Gene: bglu_1g24660: Chaperone protein HscA
 
Burkholderia xenovorans LB400

Gene: Bxe_A1557: Chaperone protein HscA
 
Burkholderia phymatum STM815

Gene: Bphy_1454: Chaperone protein HscA
Chaperone protein HscA
fdx
 
Burkholderia pseudomallei K96243

Gene: BPSL2284: Ferredoxin, 2Fe-2S type, ISC system
 
Burkholderia mallei ATCC 23344

Gene: BMA1703: Ferredoxin, 2Fe-2S type, ISC system
 
Burkholderia sp. 383

Gene: Bcep18194_A5427: Ferredoxin, 2Fe-2S type, ISC system
 
Burkholderia cepacia AMMD

Gene: Bamb_2158: Ferredoxin, 2Fe-2S type, ISC system
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_2200: Ferredoxin, 2Fe-2S type, ISC system
 
Burkholderia glumae BGR1

Gene: bglu_1g24650: Ferredoxin, 2Fe-2S type, ISC system
 
Burkholderia xenovorans LB400

Gene: Bxe_A1558: Ferredoxin, 2Fe-2S type, ISC system
 
Burkholderia phymatum STM815

Gene: Bphy_1453: Ferredoxin, 2Fe-2S type, ISC system
Ferredoxin, 2Fe-2S type, ISC system
yfhJ
 
Burkholderia pseudomallei K96243

Gene: BPSL2283: putative Fe-S cluster assembly protein
 
Burkholderia mallei ATCC 23344

Gene: BMA1702: putative Fe-S cluster assembly protein
 
Burkholderia sp. 383

Gene: Bcep18194_A5426: putative Fe-S cluster assembly protein
 
Burkholderia cepacia AMMD

Gene: Bamb_2157: putative Fe-S cluster assembly protein
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_2199: putative Fe-S cluster assembly protein
 
Burkholderia glumae BGR1

Gene: bglu_1g24640: putative Fe-S cluster assembly protein
 
Burkholderia xenovorans LB400

Gene: Bxe_A1559: putative Fe-S cluster assembly protein
 
Burkholderia phymatum STM815

Gene: Bphy_1452: putative Fe-S cluster assembly protein
putative Fe-S cluster assembly protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD