Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog IscR - Xanthomonadales

Properties
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Xylella fastidiosa 9a5c 5 1
Xanthomonas axonopodis pv. citri str. 306 5 1
Xanthomonas campestris pv. campestris str. ATCC 33913 5 1
Stenotrophomonas maltophilia K279a 6 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
iscR
*
Xylella fastidiosa 9a5c

Site:
position = -45
score = 8.3157
sequence = AAAGCGTACAATTTCTGTCCGCTTT

Gene: XF1477: Iron-sulfur cluster regulator IscR
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -42
score = 8.41628
sequence = AAAGAGTACAATTTCGGTCCGCTTT

Gene: XAC2934: Iron-sulfur cluster regulator IscR
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -44
score = 8.41628
sequence = AAAGAGTACAATTTCGGTCCGCTTT

Gene: XCC2765: Iron-sulfur cluster regulator IscR
*
Stenotrophomonas maltophilia K279a

Site:
position = -44
score = 8.3157
sequence = AAAGCGTACAATTTCAGTCCGCTTT

Gene: Smlt1158: Iron-sulfur cluster regulator IscR
Iron-sulfur cluster regulator IscR
sufB
 
Xylella fastidiosa 9a5c

Gene: XF1476: Iron-sulfur cluster assembly protein SufB
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC2935: Iron-sulfur cluster assembly protein SufB
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC2766: Iron-sulfur cluster assembly protein SufB
 
Stenotrophomonas maltophilia K279a

Gene: Smlt1157: Iron-sulfur cluster assembly protein SufB
Iron-sulfur cluster assembly protein SufB
Smlt1156
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913
 
Stenotrophomonas maltophilia K279a

Gene: Smlt1156: hypothetical protein
hypothetical protein
sufC
 
Xylella fastidiosa 9a5c

Gene: XF1475: Iron-sulfur cluster assembly ATPase protein SufC
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC2936: Iron-sulfur cluster assembly ATPase protein SufC
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC2767: Iron-sulfur cluster assembly ATPase protein SufC
 
Stenotrophomonas maltophilia K279a

Gene: Smlt1155: Iron-sulfur cluster assembly ATPase protein SufC
Iron-sulfur cluster assembly ATPase protein SufC
sufD
 
Xylella fastidiosa 9a5c

Gene: XF1474: Iron-sulfur cluster assembly protein SufD
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC2937: Iron-sulfur cluster assembly protein SufD
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC2768: Iron-sulfur cluster assembly protein SufD
 
Stenotrophomonas maltophilia K279a

Gene: Smlt1154: Iron-sulfur cluster assembly protein SufD
Iron-sulfur cluster assembly protein SufD
sufS
 
Xylella fastidiosa 9a5c

Gene: XF1473: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC2938: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC2769: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Stenotrophomonas maltophilia K279a

Gene: Smlt1153: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD