Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog IscR - Moraxellaceae

Properties
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acinetobacter sp. ADP1 7 1
Acinetobacter baumannii AB0057 7 1
Psychrobacter arcticum 273-4 7 1
Psychrobacter sp. PRwf-1 7 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
iscR
*
Acinetobacter sp. ADP1

Site:
position = -96
score = 7.98869
sequence = AAACTTGACTATTTTAGTCAGGATT

Gene: ACIAD1405: Iron-sulfur cluster regulator IscR
*
Acinetobacter baumannii AB0057

Site:
position = -66
score = 8.15517
sequence = AAACTTGACTATTTTAGTCGGGATT

Gene: AB57_1857: Iron-sulfur cluster regulator IscR
*
Psychrobacter arcticum 273-4

Site:
position = -219
score = 7.88673
sequence = AATCTTGACTAAATTACTCGGGATT

Gene: Psyc_1476: Iron-sulfur cluster regulator IscR
*
Psychrobacter sp. PRwf-1

Site:
position = -75
score = 8.05321
sequence = AATCTTGACTAGTTTACTCGGGATT

Gene: PsycPRwf_1628: Iron-sulfur cluster regulator IscR
Iron-sulfur cluster regulator IscR
iscS
 
Acinetobacter sp. ADP1

Gene: ACIAD1404: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Acinetobacter baumannii AB0057

Gene: AB57_1856: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Psychrobacter arcticum 273-4

Gene: Psyc_1477: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Psychrobacter sp. PRwf-1

Gene: PsycPRwf_1629: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
iscU
 
Acinetobacter sp. ADP1

Gene: ACIAD1403: Iron-sulfur cluster assembly scaffold protein IscU
 
Acinetobacter baumannii AB0057

Gene: AB57_1855: Iron-sulfur cluster assembly scaffold protein IscU
 
Psychrobacter arcticum 273-4

Gene: Psyc_1478: Iron-sulfur cluster assembly scaffold protein IscU
 
Psychrobacter sp. PRwf-1

Gene: PsycPRwf_1630: Iron-sulfur cluster assembly scaffold protein IscU
Iron-sulfur cluster assembly scaffold protein IscU
iscA
 
Acinetobacter sp. ADP1

Gene: ACIAD1402: Iron binding protein IscA for iron-sulfur cluster assembly
 
Acinetobacter baumannii AB0057

Gene: AB57_1854: Iron binding protein IscA for iron-sulfur cluster assembly
 
Psychrobacter arcticum 273-4

Gene: Psyc_1479: Iron binding protein IscA for iron-sulfur cluster assembly
 
Psychrobacter sp. PRwf-1

Gene: PsycPRwf_1631: Iron binding protein IscA for iron-sulfur cluster assembly
Iron binding protein IscA for iron-sulfur cluster assembly
hscB
 
Acinetobacter sp. ADP1

Gene: ACIAD1400: Chaperone protein HscB
 
Acinetobacter baumannii AB0057

Gene: AB57_1853: Chaperone protein HscB
 
Psychrobacter arcticum 273-4

Gene: Psyc_1480: Chaperone protein HscB
 
Psychrobacter sp. PRwf-1

Gene: PsycPRwf_1632: Chaperone protein HscB
Chaperone protein HscB
hscA
 
Acinetobacter sp. ADP1

Gene: ACIAD1399: Chaperone protein HscA
 
Acinetobacter baumannii AB0057

Gene: AB57_1852: Chaperone protein HscA
 
Psychrobacter arcticum 273-4

Gene: Psyc_1481: Chaperone protein HscA
 
Psychrobacter sp. PRwf-1

Gene: PsycPRwf_1633: Chaperone protein HscA
Chaperone protein HscA
fdx
 
Acinetobacter sp. ADP1

Gene: ACIAD1398: ferredoxin, 2Fe-2S type, ISC system
 
Acinetobacter baumannii AB0057

Gene: AB57_1851: ferredoxin, 2Fe-2S type, ISC system
 
Psychrobacter arcticum 273-4

Gene: Psyc_1482: ferredoxin, 2Fe-2S type, ISC system
 
Psychrobacter sp. PRwf-1

Gene: PsycPRwf_1634: ferredoxin, 2Fe-2S type, ISC system
ferredoxin, 2Fe-2S type, ISC system
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD