Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog IscR - Pseudomonadaceae

Properties
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 15 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Pseudomonas aeruginosa PAO1 9 2
Pseudomonas entomophila L48 9 2
Pseudomonas putida KT2440 9 2
Pseudomonas syringae pv. tomato str. DC3000 9 2
Pseudomonas fluorescens Pf-5 9 2
Pseudomonas mendocina ymp 9 2
Pseudomonas stutzeri A1501 9 2
Azotobacter vinelandii AvOP 8 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
iscR
*
Pseudomonas aeruginosa PAO1

Site:
position = -71
score = 7.11054
sequence = ATAGTTGACCTAATTACTCGGATAA

Gene: PA3815: Iron-sulfur cluster regulator IscR
*
Pseudomonas entomophila L48

Site:
position = -70
score = 7.00091
sequence = ATAGTTGACTTAAATGCTCGGGAAT

Gene: PSEEN1009: Iron-sulfur cluster regulator IscR
*
Pseudomonas putida KT2440

Site:
position = -70
score = 7.00091
sequence = ATAGTTGACTTAAATGCTCGGGAAT

Gene: PP0841: Iron-sulfur cluster regulator IscR
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -65
score = 7.12008
sequence = ATAGTTGACTAATTTGCTCGGGAAT

Gene: PSPTO1422: Iron-sulfur cluster regulator IscR
*
Pseudomonas fluorescens Pf-5

Site:
position = -66
score = 6.96814
sequence = ATAGTTGACCTGATTACTCGGGTAT

Gene: PFL_4966: Iron-sulfur cluster regulator IscR
*
Pseudomonas mendocina ymp

Site:
position = -64
score = 7.04009
sequence = ATAGTTGACTTAAATACTCGGGAAT

Gene: Pmen_3512: Iron-sulfur cluster regulator IscR
*
Pseudomonas stutzeri A1501

Site:
position = -4
score = 6.91741
sequence = ATAGTTGACTCAAATACTCGGGAAT

Gene: PST_3043: Iron-sulfur cluster regulator IscR
*
Azotobacter vinelandii AvOP

Site:
position = -65
score = 6.10082
sequence = ATAGTTGATCCTGTTTGTCGGGTAT

Gene: Avin_40410: Iron-sulfur cluster regulator IscR
Iron-sulfur cluster regulator IscR
iscS
 
Pseudomonas aeruginosa PAO1

Gene: PA3814: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Pseudomonas entomophila L48

Gene: PSEEN1010: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Pseudomonas putida KT2440

Gene: PP0842: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO1423: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Pseudomonas fluorescens Pf-5

Gene: PFL_4965: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Pseudomonas mendocina ymp

Gene: Pmen_3511: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Pseudomonas stutzeri A1501

Gene: PST_3042: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Azotobacter vinelandii AvOP

Gene: Avin_40400: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
iscU
 
Pseudomonas aeruginosa PAO1

Gene: PA3813: Iron-sulfur cluster assembly scaffold protein IscU
 
Pseudomonas entomophila L48

Gene: PSEEN1011: Iron-sulfur cluster assembly scaffold protein IscU
 
Pseudomonas putida KT2440

Gene: PP0843: Iron-sulfur cluster assembly scaffold protein IscU
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO1424: Iron-sulfur cluster assembly scaffold protein IscU
 
Pseudomonas fluorescens Pf-5

Gene: PFL_4964: Iron-sulfur cluster assembly scaffold protein IscU
 
Pseudomonas mendocina ymp

Gene: Pmen_3510: Iron-sulfur cluster assembly scaffold protein IscU
 
Pseudomonas stutzeri A1501

Gene: PST_3041: Iron-sulfur cluster assembly scaffold protein IscU
 
Azotobacter vinelandii AvOP

Gene: Avin_40390: Iron-sulfur cluster assembly scaffold protein IscU
Iron-sulfur cluster assembly scaffold protein IscU
iscA
 
Pseudomonas aeruginosa PAO1

Gene: PA3812: Iron binding protein IscA for iron-sulfur cluster assembly
 
Pseudomonas entomophila L48

Gene: PSEEN1012: Iron binding protein IscA for iron-sulfur cluster assembly
 
Pseudomonas putida KT2440

Gene: PP0844: Iron binding protein IscA for iron-sulfur cluster assembly
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO1425: Iron binding protein IscA for iron-sulfur cluster assembly
 
Pseudomonas fluorescens Pf-5

Gene: PFL_4963: Iron binding protein IscA for iron-sulfur cluster assembly
 
Pseudomonas mendocina ymp

Gene: Pmen_3509: Iron binding protein IscA for iron-sulfur cluster assembly
 
Pseudomonas stutzeri A1501

Gene: PST_3040: Iron binding protein IscA for iron-sulfur cluster assembly
 
Azotobacter vinelandii AvOP

Gene: Avin_40380: Iron binding protein IscA for iron-sulfur cluster assembly
Iron binding protein IscA for iron-sulfur cluster assembly
hscB
 
Pseudomonas aeruginosa PAO1

Gene: PA3811: Chaperone protein HscB
 
Pseudomonas entomophila L48

Gene: PSEEN1013: Chaperone protein HscB
 
Pseudomonas putida KT2440

Gene: PP0845: Chaperone protein HscB
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO1426: Chaperone protein HscB
 
Pseudomonas fluorescens Pf-5

Gene: PFL_4962: Chaperone protein HscB
 
Pseudomonas mendocina ymp

Gene: Pmen_3508: Chaperone protein HscB
 
Pseudomonas stutzeri A1501

Gene: PST_3039: Chaperone protein HscB
 
Azotobacter vinelandii AvOP

Gene: Avin_40370: Chaperone protein HscB
Chaperone protein HscB
hscA
 
Pseudomonas aeruginosa PAO1

Gene: PA3810: Chaperone protein HscA
 
Pseudomonas entomophila L48

Gene: PSEEN1014: Chaperone protein HscA
 
Pseudomonas putida KT2440

Gene: PP0846: Chaperone protein HscA
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO1427: Chaperone protein HscA
 
Pseudomonas fluorescens Pf-5

Gene: PFL_4961: Chaperone protein HscA
 
Pseudomonas mendocina ymp

Gene: Pmen_3507: Chaperone protein HscA
 
Pseudomonas stutzeri A1501

Gene: PST_3038: Chaperone protein HscA
 
Azotobacter vinelandii AvOP

Gene: Avin_40360: Chaperone protein HscA
Chaperone protein HscA
fdx
 
Pseudomonas aeruginosa PAO1

Gene: PA3809: ferredoxin, 2Fe-2S type, ISC system
 
Pseudomonas entomophila L48

Gene: PSEEN1015: ferredoxin, 2Fe-2S type, ISC system
 
Pseudomonas putida KT2440

Gene: PP0847: ferredoxin, 2Fe-2S type, ISC system
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO1428: ferredoxin, 2Fe-2S type, ISC system
 
Pseudomonas fluorescens Pf-5

Gene: PFL_4960: ferredoxin, 2Fe-2S type, ISC system
 
Pseudomonas mendocina ymp

Gene: Pmen_3506: ferredoxin, 2Fe-2S type, ISC system
 
Pseudomonas stutzeri A1501

Gene: PST_3037: ferredoxin, 2Fe-2S type, ISC system
 
Azotobacter vinelandii AvOP

Gene: Avin_40350: ferredoxin, 2Fe-2S type, ISC system
ferredoxin, 2Fe-2S type, ISC system
yfhJ
 
Pseudomonas aeruginosa PAO1

Gene: PA3808: putative Fe-S cluster assembly protein
 
Pseudomonas entomophila L48

Gene: PSEEN1016: putative Fe-S cluster assembly protein
 
Pseudomonas putida KT2440

Gene: PP0848: putative Fe-S cluster assembly protein
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO1429: putative Fe-S cluster assembly protein
 
Pseudomonas fluorescens Pf-5

Gene: PFL_4959: putative Fe-S cluster assembly protein
 
Pseudomonas mendocina ymp

Gene: Pmen_3505: putative Fe-S cluster assembly protein
 
Pseudomonas stutzeri A1501

Gene: PST_3036: putative Fe-S cluster assembly protein
 
Azotobacter vinelandii AvOP

Gene: Avin_40340: putative Fe-S cluster assembly protein
putative Fe-S cluster assembly protein
 
CRON 2.
erpA
*
Pseudomonas aeruginosa PAO1

Site:
position = -81
score = 6.35212
sequence = TTAGTTGACCATTTTTCTGGGACAA

Gene: PA0665: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Pseudomonas entomophila L48

Site:
position = -79
score = 6.72428
sequence = ATTCTTGACCGATTTTCTCGGAGAA

Gene: PSEEN0461: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Pseudomonas putida KT2440

Site:
position = -32
score = 6.92285
sequence = ATTCTTGACCGATTTTCTCGGGAAA

Gene: PP0433: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -93
score = 6.92263
sequence = ATAGTTGACCGATTTTCTAGGAGAA

Gene: PSPTO0605: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Pseudomonas fluorescens Pf-5

Site:
position = -81
score = 6.69818
sequence = ATAGTTGACCGCTTTTCTGGGAGAA

Gene: PFL_5610: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Pseudomonas mendocina ymp

Site:
position = -77
score = 7.28377
sequence = ATAGTTGACCAATTTTCTCGGGCAA

Gene: Pmen_3930: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Pseudomonas stutzeri A1501

Site:
position = -76
score = 6.51231
sequence = ATAGTTGACCGGTTTTGTCAGGCAA

Gene: PST_0755: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
 
Azotobacter vinelandii AvOP

Gene: Avin_46030: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD