Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog IscR - Oceanospirillales/Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 41 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Hahella chejuensis KCTC 2396 4 3
Marinobacter aqueolei 11 4
Marinobacter sp. ELB17 10 3
Oceanobacter sp. RED65 10 3
Oceanospirillum sp. MED92 9 3
Marinomonas sp. MWYL1 11 3
Saccharophagus degradans 2-40 12 4
Teredinibacter turnerae T7901 11 3
Cellvibrio japonicus Ueda107 11 4
Chromohalobacter salexigens DSM 3043 4 2
Reinekea sp. MED297 12 4
Alcanivorax borkumensis SK2 11 4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
erpA
*
Hahella chejuensis KCTC 2396

Site:
position = -103
score = 5.48366
sequence = ATAGTTGACCGATTAAGTAGGATAA

Gene: HCH_06242: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Marinobacter aqueolei

Site:
position = -87
score = 6.03067
sequence = ATAGTTGATTGTTTTAGTCAGGAAT

Gene: Maqu_0694: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Marinobacter sp. ELB17

Site:
position = -66
score = 6.03067
sequence = ATAGTTGATTGTTTTAGTCAGGAAT

Gene: MELB17_20316: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Oceanobacter sp. RED65

Site:
position = -70
score = 5.74346
sequence = TTAGTTGACTAGAATACTCGGGTTT

Gene: RED65_11832: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Oceanospirillum sp. MED92

Site:
position = -61
score = 6.06413
sequence = ATACTTGACTGAATTGCTTGGTTAA

Gene: MED92_17445: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Marinomonas sp. MWYL1

Site:
position = -66
score = 6.2935
sequence = ATACTTGACTAAATTACTCGGATAA

Gene: Mmwyl1_1012: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Saccharophagus degradans 2-40

Site:
position = -66
score = 6.10036
sequence = ATACTTGATTGTTTTAGTCGGTTAA

Gene: Sde_0836: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Teredinibacter turnerae T7901

Site:
position = -86
score = 5.8464
sequence = ATACTTGACTGAAACACTCGGGTAC

Gene: TERTU_3061: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Cellvibrio japonicus Ueda107

Site:
position = -76
score = 6.00973
sequence = ATAGTTGACTGTTTTGCTGGGGTAA

Gene: CJA_0888: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Chromohalobacter salexigens DSM 3043

Site:
position = -76
score = 5.50745
sequence = AAAGTTGACCGTTTTGCTTGGTCTT

Gene: Csal_3299: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Reinekea sp. MED297

Site:
position = -63
score = 6.33485
sequence = ATAGTTGACTGTTTTGCTCAGGTAT

Gene: MED297_10476: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Alcanivorax borkumensis SK2

Site:
position = 9
score = 5.7525
sequence = ATTCTTGACTGTTTTAGTCGGGTAC

Gene: ABO_0362: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
 
CRON 2.
iscR
*
Hahella chejuensis KCTC 2396

Site:
position = -59
score = 4.97356
sequence = ATACTTGATCAGTTTGCAGGGTCAT

Gene: HCH_04462: Iron-sulfur cluster regulator IscR
*
Marinobacter aqueolei

Site:
position = -78
score = 5.93655
sequence = ATACTTGACTGTTTTAGTTGGTCAA

Gene: Maqu_1121: Iron-sulfur cluster regulator IscR
*
Marinobacter sp. ELB17

Site:
position = -77
score = 6.0661
sequence = ATACTTGACTGAATTAGTAGGTCAA

Gene: MELB17_11313: Iron-sulfur cluster regulator IscR
*
Oceanobacter sp. RED65

Site:
position = -74
score = 6.18819
sequence = AAAGTTGACTAAAATACTCGGGTTT

Gene: RED65_06117: Iron-sulfur cluster regulator IscR
*
Oceanospirillum sp. MED92

Site:
position = -68
score = 5.36451
sequence = TTAATTGACCTTTTTGGTCGGGTAT

Gene: MED92_00535: Iron-sulfur cluster regulator IscR
*
Marinomonas sp. MWYL1

Site:
position = -93
score = 5.50043
sequence = ATAACCTACTAAAATAGTCAGGTAA

Site:
position = -68
score = 5.34063
sequence = ATACTTGATCAAAACAGTAGGATTT

Gene: Mmwyl1_1343: Iron-sulfur cluster regulator IscR
*
Saccharophagus degradans 2-40

Site:
position = -61
score = 5.99801
sequence = ATACTTGATTGAAATGCTAGGTTAT

Gene: Sde_1412: Iron-sulfur cluster regulator IscR
*
Teredinibacter turnerae T7901

Site:
position = -64
score = 6.0626
sequence = ATAGTTGACCGCATTACTCGGTTAT

Gene: TERTU_2649: Iron-sulfur cluster regulator IscR
*
Cellvibrio japonicus Ueda107

Site:
position = -131
score = 6.12287
sequence = ATAGTTGAGTAAAATACTCGGGTTT

Gene: CJA_1465: Iron-sulfur cluster regulator IscR
*
Chromohalobacter salexigens DSM 3043

Site:
position = -71
score = 4.98502
sequence = ATGGTTGACCGCGTTACTGGGTTTT

Gene: Csal_2847: Iron-sulfur cluster regulator IscR
*
Reinekea sp. MED297

Site:
position = -107
score = 6.33485
sequence = ATAGTTGACTGTTTTGCTCAGGTAT

Gene: MED297_14930: Iron-sulfur cluster regulator IscR
*
Alcanivorax borkumensis SK2

Site:
position = -66
score = 6.01189
sequence = ATACTTGACCAAATTGCTCAGGATT

Gene: ABO_1873: Iron-sulfur cluster regulator IscR
Iron-sulfur cluster regulator IscR
sufB
 
Hahella chejuensis KCTC 2396

Gene: HCH_01416: Iron-sulfur cluster assembly protein SufB
*
Marinobacter aqueolei

Site:
position = -223
score = 6.29932
sequence = ATACCTGACTATTTTACTCTGGTAT

Gene: Maqu_3151: Iron-sulfur cluster assembly protein SufB
*2
Marinobacter sp. ELB17

Gene: MELB17_12967: Iron-sulfur cluster assembly protein SufB

Site:
position = -131
score = 6.19847
sequence = ATACCTGACTAAAATACTCTGGTAT

Gene: MELB17_04217: Iron-sulfur cluster assembly protein SufB
 
Oceanobacter sp. RED65

Gene: RED65_06107: Iron-sulfur cluster assembly protein SufB
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_1344: Iron-sulfur cluster assembly protein SufB
 
Saccharophagus degradans 2-40

Gene: Sde_1414: Iron-sulfur cluster assembly protein SufB
 
Teredinibacter turnerae T7901

Gene: TERTU_2647: Iron-sulfur cluster assembly protein SufB
 
Cellvibrio japonicus Ueda107

Gene: CJA_1467: Iron-sulfur cluster assembly protein SufB
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_1233: Iron-sulfur cluster assembly protein SufB
 
Reinekea sp. MED297

Gene: MED297_14940: Iron-sulfur cluster assembly protein SufB
*
Alcanivorax borkumensis SK2

Site:
position = -45
score = 6.19847
sequence = ATACCCGACTAAATTACTCTGGTAT

Gene: ABO_1865: Iron-sulfur cluster assembly protein SufB
Iron-sulfur cluster assembly protein SufB
sufC
 
Hahella chejuensis KCTC 2396

Gene: HCH_01414: Iron-sulfur cluster assembly ATPase protein SufC
 
Marinobacter aqueolei

Gene: Maqu_3152: Iron-sulfur cluster assembly ATPase protein SufC
 2
Marinobacter sp. ELB17

Gene: MELB17_12972: Iron-sulfur cluster assembly ATPase protein SufC

Gene: MELB17_04212: Iron-sulfur cluster assembly ATPase protein SufC
 
Oceanobacter sp. RED65

Gene: RED65_06102: Iron-sulfur cluster assembly ATPase protein SufC
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_1345: Iron-sulfur cluster assembly ATPase protein SufC
 
Saccharophagus degradans 2-40

Gene: Sde_1415: Iron-sulfur cluster assembly ATPase protein SufC
 
Teredinibacter turnerae T7901

Gene: TERTU_2646: Iron-sulfur cluster assembly ATPase protein SufC
 
Cellvibrio japonicus Ueda107

Gene: CJA_1468: Iron-sulfur cluster assembly ATPase protein SufC
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_1234: Iron-sulfur cluster assembly ATPase protein SufC
 
Reinekea sp. MED297

Gene: MED297_14945: Iron-sulfur cluster assembly ATPase protein SufC
 
Alcanivorax borkumensis SK2

Gene: ABO_1866: Iron-sulfur cluster assembly ATPase protein SufC
Iron-sulfur cluster assembly ATPase protein SufC
sufD
 
Hahella chejuensis KCTC 2396

Gene: HCH_01413: Iron-sulfur cluster assembly protein SufD
 
Marinobacter aqueolei

Gene: Maqu_3153: Iron-sulfur cluster assembly protein SufD
 2
Marinobacter sp. ELB17

Gene: MELB17_12977: Iron-sulfur cluster assembly protein SufD

Gene: MELB17_04207: Iron-sulfur cluster assembly protein SufD
 
Oceanobacter sp. RED65

Gene: RED65_06097: Iron-sulfur cluster assembly protein SufD
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_1346: Iron-sulfur cluster assembly protein SufD
 
Saccharophagus degradans 2-40

Gene: Sde_1416: Iron-sulfur cluster assembly protein SufD
 
Teredinibacter turnerae T7901

Gene: TERTU_2645: Iron-sulfur cluster assembly protein SufD
 
Cellvibrio japonicus Ueda107

Gene: CJA_1469: Iron-sulfur cluster assembly protein SufD
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_1235: Iron-sulfur cluster assembly protein SufD
 
Reinekea sp. MED297

Gene: MED297_14950: Iron-sulfur cluster assembly protein SufD
 
Alcanivorax borkumensis SK2

Gene: ABO_1867: Iron-sulfur cluster assembly protein SufD
Iron-sulfur cluster assembly protein SufD
sufS
 
Hahella chejuensis KCTC 2396

Gene: HCH_01412: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Marinobacter aqueolei

Gene: Maqu_3154: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Marinobacter sp. ELB17

Gene: MELB17_04202: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Oceanobacter sp. RED65

Gene: RED65_06092: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Oceanospirillum sp. MED92

Gene: MED92_10989: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_1347: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Saccharophagus degradans 2-40

Gene: Sde_1417: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Teredinibacter turnerae T7901

Gene: TERTU_2644: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Cellvibrio japonicus Ueda107

Gene: CJA_1470: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_1236: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Reinekea sp. MED297

Gene: MED297_14955: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Alcanivorax borkumensis SK2

Gene: ABO_1868: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
sufA
 
Hahella chejuensis KCTC 2396

Gene: HCH_01411: Iron binding protein SufA for iron-sulfur cluster assembly
 
Marinobacter aqueolei

Gene: Maqu_3155: Iron binding protein SufA for iron-sulfur cluster assembly
 2
Marinobacter sp. ELB17

Gene: MELB17_12982: Iron binding protein SufA for iron-sulfur cluster assembly

Gene: MELB17_04197: Iron binding protein SufA for iron-sulfur cluster assembly
 
Oceanobacter sp. RED65

Gene: RED65_06087: Iron binding protein SufA for iron-sulfur cluster assembly
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_1348: Iron binding protein SufA for iron-sulfur cluster assembly
 
Saccharophagus degradans 2-40

Gene: Sde_1418: Iron binding protein SufA for iron-sulfur cluster assembly
 
Teredinibacter turnerae T7901

Gene: TERTU_2643: Iron binding protein SufA for iron-sulfur cluster assembly
 
Cellvibrio japonicus Ueda107

Gene: CJA_1471: Iron binding protein SufA for iron-sulfur cluster assembly
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297

Gene: MED297_14960: Iron binding protein SufA for iron-sulfur cluster assembly
 
Alcanivorax borkumensis SK2

Gene: ABO_1869: Iron binding protein SufA for iron-sulfur cluster assembly
Iron binding protein SufA for iron-sulfur cluster assembly
sufT
 
Hahella chejuensis KCTC 2396

Gene: HCH_01409: Iron sulfur cluster assembly protein SufT
 
Marinobacter aqueolei

Gene: Maqu_3156: Iron sulfur cluster assembly protein SufT
 
Marinobacter sp. ELB17

Gene: MELB17_04192: Iron sulfur cluster assembly protein SufT
 
Oceanobacter sp. RED65

Gene: RED65_06082: Iron sulfur cluster assembly protein SufT
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_1349: Iron sulfur cluster assembly protein SufT
 
Saccharophagus degradans 2-40

Gene: Sde_1419: Iron sulfur cluster assembly protein SufT
 
Teredinibacter turnerae T7901

Gene: TERTU_2641: Iron sulfur cluster assembly protein SufT
 
Cellvibrio japonicus Ueda107

Gene: CJA_1472: Iron sulfur cluster assembly protein SufT
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_1237: Iron sulfur cluster assembly protein SufT
 
Reinekea sp. MED297

Gene: MED297_14965: Iron sulfur cluster assembly protein SufT
 
Alcanivorax borkumensis SK2

Gene: ABO_1870: Iron sulfur cluster assembly protein SufT
Iron sulfur cluster assembly protein SufT
sufE
 
Hahella chejuensis KCTC 2396

Gene: HCH_01408: Sulfur acceptor protein SufE for iron-sulfur cluster assembly
 
Marinobacter aqueolei

Gene: Maqu_3157: Sulfur acceptor protein SufE for iron-sulfur cluster assembly
 
Marinobacter sp. ELB17

Gene: MELB17_04187: Sulfur acceptor protein SufE for iron-sulfur cluster assembly
 
Oceanobacter sp. RED65

Gene: RED65_06067: Sulfur acceptor protein SufE for iron-sulfur cluster assembly
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_1350: Sulfur acceptor protein SufE for iron-sulfur cluster assembly
 
Saccharophagus degradans 2-40

Gene: Sde_1420: Sulfur acceptor protein SufE for iron-sulfur cluster assembly
 
Teredinibacter turnerae T7901

Gene: TERTU_2640: Sulfur acceptor protein SufE for iron-sulfur cluster assembly
 2
Cellvibrio japonicus Ueda107

Gene: CJA_1476: Sulfur acceptor protein SufE for iron-sulfur cluster assembly

Gene: CJA_1184: Sulfur acceptor protein SufE for iron-sulfur cluster assembly
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297

Gene: MED297_14970: Sulfur acceptor protein SufE for iron-sulfur cluster assembly
 
Alcanivorax borkumensis SK2

Gene: ABO_1871: Sulfur acceptor protein SufE for iron-sulfur cluster assembly
Sulfur acceptor protein SufE for iron-sulfur cluster assembly
iscS
 
Hahella chejuensis KCTC 2396

Gene: HCH_04461: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Marinobacter aqueolei

Gene: Maqu_1122: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Marinobacter sp. ELB17

Gene: MELB17_11318: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Oceanobacter sp. RED65

Gene: RED65_06112: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Oceanospirillum sp. MED92

Gene: MED92_00540: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_1351: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Saccharophagus degradans 2-40

Gene: Sde_1413: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Teredinibacter turnerae T7901

Gene: TERTU_2648: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Cellvibrio japonicus Ueda107

Gene: CJA_1466: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_2848: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Reinekea sp. MED297

Gene: MED297_14935: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Alcanivorax borkumensis SK2

Gene: ABO_1872: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
iscU
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92

Gene: MED92_00545: Iron-sulfur cluster assembly scaffold protein IscU
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Iron-sulfur cluster assembly scaffold protein IscU
iscA
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92

Gene: MED92_00550: Iron binding protein IscA for iron-sulfur cluster assembly
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_2849: Iron binding protein IscA for iron-sulfur cluster assembly
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Iron binding protein IscA for iron-sulfur cluster assembly
hscB
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92

Gene: MED92_00555: Chaperone protein HscB
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Chaperone protein HscB
hscA
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92

Gene: MED92_00560: Chaperone protein HscA
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Chaperone protein HscA
fdx
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92

Gene: MED92_00565: ferredoxin, 2Fe-2S type, ISC system
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
ferredoxin, 2Fe-2S type, ISC system
 
CRON 3.
nfuA
*
Hahella chejuensis KCTC 2396

Site:
position = -86
score = 5.10512
sequence = AAATCCTACTAATTTGCTAAGGCTT

Gene: HCH_02543: NfuA Fe-S protein maturation
*
Marinobacter aqueolei

Site:
position = -82
score = 5.54031
sequence = ATGCCCGACTATTTTACTTGGTCTT

Gene: Maqu_1525: NfuA Fe-S protein maturation
 
Marinobacter sp. ELB17

Gene: MELB17_13022: NfuA Fe-S protein maturation
*
Oceanobacter sp. RED65

Site:
position = -78
score = 5.2824
sequence = ATACCCGAGTAAAAAACTAGGGATT

Gene: RED65_07139: NfuA Fe-S protein maturation
*
Oceanospirillum sp. MED92

Site:
position = -79
score = 6.05126
sequence = ATAGTTGATCAATTTACTCGGGATT

Gene: MED92_12256: NfuA Fe-S protein maturation
*
Marinomonas sp. MWYL1

Site:
position = -93
score = 5.34915
sequence = ATACCCTACTTTTTTACTTGGTCTT

Gene: Mmwyl1_2344: NfuA Fe-S protein maturation
*
Saccharophagus degradans 2-40

Site:
position = -38
score = 5.43569
sequence = ATAACCGACAAATTTACTAGGTCTT

Gene: Sde_2009: NfuA Fe-S protein maturation
*
Teredinibacter turnerae T7901

Site:
position = -69
score = 5.84963
sequence = ATACCCAACTAAATTAGTAGGGTAT

Gene: TERTU_2127: NfuA Fe-S protein maturation
*
Cellvibrio japonicus Ueda107

Site:
position = -66
score = 5.64321
sequence = ATACCCGAGTATTTTAATCAGGTAT

Gene: CJA_2541: NfuA Fe-S protein maturation
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_1888: NfuA Fe-S protein maturation
*
Reinekea sp. MED297

Site:
position = -86
score = 6.23541
sequence = AAAGCTGACTAAATTACTCAGGTAT

Gene: MED297_01820: NfuA Fe-S protein maturation
*
Alcanivorax borkumensis SK2

Site:
position = -101
score = 5.5031
sequence = GTACCTGACTAAAATAGTCAGGAAA

Gene: ABO_1190: NfuA Fe-S protein maturation
NfuA Fe-S protein maturation
 
CRON 4.
ydhD
 
Hahella chejuensis KCTC 2396

Gene: HCH_01764: Probable monothiol glutaredoxin ydhD
 
Marinobacter aqueolei

Gene: Maqu_2316: Probable monothiol glutaredoxin ydhD
 
Marinobacter sp. ELB17

Gene: MELB17_18479: Probable monothiol glutaredoxin ydhD
 
Oceanobacter sp. RED65

Gene: RED65_00280: Probable monothiol glutaredoxin ydhD
 
Oceanospirillum sp. MED92

Gene: MED92_02309: Probable monothiol glutaredoxin ydhD
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_3388: Probable monothiol glutaredoxin ydhD
*
Saccharophagus degradans 2-40

Site:
position = -68
score = 5.36613
sequence = ATACCCGAGTAAATAACTCAGATTT

Gene: Sde_2438: Probable monothiol glutaredoxin ydhD
 2
Teredinibacter turnerae T7901

Gene: TERTU_1515: Probable monothiol glutaredoxin ydhD

Gene: TERTU_0735: Probable monothiol glutaredoxin ydhD
*
Cellvibrio japonicus Ueda107

Site:
position = -74
score = 5.97721
sequence = ATACTTGACTGCATTACTTGGTTTT

Gene: CJA_2843: Probable monothiol glutaredoxin ydhD
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_2129: Probable monothiol glutaredoxin ydhD
*
Reinekea sp. MED297

Site:
position = -25
score = 5.40641
sequence = ATATCTGAGCGATTTGGTAGGTTAT

Gene: MED297_14062: Probable monothiol glutaredoxin ydhD
 
Alcanivorax borkumensis SK2

Gene: ABO_0722: Probable monothiol glutaredoxin ydhD
Probable monothiol glutaredoxin ydhD
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD