Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog IscR - Psychromonadaceae/Aeromonadales

Properties
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Psychromonas ingrahamii 37 9 2
Psychromonas sp. CNPT3 9 2
Moritella sp. PE36 9 2
Aeromonas hydrophila subsp. hydrophila ATCC 7966 8 2
Aeromonas salmonicida subsp. salmonicida A449 9 2
Tolumonas auensis DSM 9187 8 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
iscR
*
Psychromonas ingrahamii 37

Site:
position = -106
score = 6.94469
sequence = TTACTTGACTATTTTTGTCAGGTAT

Site:
position = -133
score = 6.70842
sequence = TTACCTGACTATTTTTGTCAGGTAT

Gene: Ping_1323: Iron-sulfur cluster regulator IscR
*
Psychromonas sp. CNPT3

Site:
position = -99
score = 6.90697
sequence = TTAGTTGACTAATTTAGTAGGGTAT

Gene: PCNPT3_05479: Iron-sulfur cluster regulator IscR
*
Moritella sp. PE36

Site:
position = -62
score = 7.115
sequence = ATACTTGACCATTTCAGTCGGGTAT

Site:
position = -87
score = 6.89047
sequence = ATACCTGAGTAAATTAGTCAGGTAT

Gene: PE36_21624: Iron-sulfur cluster regulator IscR
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -70
score = 7.4528
sequence = ATACTTGACTGATTTAGTCGGGTAT

Gene: AHA_1746: Iron-sulfur cluster regulator IscR
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -70
score = 7.37361
sequence = ATACTTGACTGTTTTAGTCGGGTAT

Gene: ASA_2613: Iron-sulfur cluster regulator IscR
*
Tolumonas auensis DSM 9187

Site:
position = -56
score = 6.06912
sequence = ATACTTGACTGAAAAAGTAGGACAT

Gene: Tola_2020: Iron-sulfur cluster regulator IscR
Iron-sulfur cluster regulator IscR
iscS
 
Psychromonas ingrahamii 37

Gene: Ping_1324: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Psychromonas sp. CNPT3

Gene: PCNPT3_05484: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Moritella sp. PE36

Gene: PE36_21619: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1747: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_2612: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Tolumonas auensis DSM 9187

Gene: Tola_2019: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
iscU
 
Psychromonas ingrahamii 37

Gene: Ping_1325: Iron-sulfur cluster assembly scaffold protein IscU
 
Psychromonas sp. CNPT3

Gene: PCNPT3_05489: Iron-sulfur cluster assembly scaffold protein IscU
 
Moritella sp. PE36

Gene: PE36_21614: Iron-sulfur cluster assembly scaffold protein IscU
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1748: Iron-sulfur cluster assembly scaffold protein IscU
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_2611: Iron-sulfur cluster assembly scaffold protein IscU
 
Tolumonas auensis DSM 9187

Gene: Tola_2018: Iron-sulfur cluster assembly scaffold protein IscU
Iron-sulfur cluster assembly scaffold protein IscU
iscA
 
Psychromonas ingrahamii 37

Gene: Ping_1326: Iron binding protein IscA for iron-sulfur cluster assembly
 
Psychromonas sp. CNPT3

Gene: PCNPT3_05494: Iron binding protein IscA for iron-sulfur cluster assembly
 
Moritella sp. PE36

Gene: PE36_21609: Iron binding protein IscA for iron-sulfur cluster assembly
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1749: Iron binding protein IscA for iron-sulfur cluster assembly
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_2610: Iron binding protein IscA for iron-sulfur cluster assembly
 
Tolumonas auensis DSM 9187

Gene: Tola_2017: Iron binding protein IscA for iron-sulfur cluster assembly
Iron binding protein IscA for iron-sulfur cluster assembly
hscB
 
Psychromonas ingrahamii 37

Gene: Ping_1327: Chaperone protein HscB
 
Psychromonas sp. CNPT3

Gene: PCNPT3_05499: Chaperone protein HscB
 
Moritella sp. PE36

Gene: PE36_21604: Chaperone protein HscB
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1750: Chaperone protein HscB
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_2608: Chaperone protein HscB
 
Tolumonas auensis DSM 9187

Gene: Tola_2016: Chaperone protein HscB
Chaperone protein HscB
hscA
 
Psychromonas ingrahamii 37

Gene: Ping_1328: Chaperone protein HscA
 
Psychromonas sp. CNPT3

Gene: PCNPT3_05504: Chaperone protein HscA
 
Moritella sp. PE36

Gene: PE36_21599: Chaperone protein HscA
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1751: Chaperone protein HscA
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_2607: Chaperone protein HscA
 
Tolumonas auensis DSM 9187

Gene: Tola_2015: Chaperone protein HscA
Chaperone protein HscA
fdx
 
Psychromonas ingrahamii 37

Gene: Ping_1329: ferredoxin, 2Fe-2S type, ISC system
 
Psychromonas sp. CNPT3

Gene: PCNPT3_05509: ferredoxin, 2Fe-2S type, ISC system
 
Moritella sp. PE36

Gene: PE36_21594: ferredoxin, 2Fe-2S type, ISC system
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1752: ferredoxin, 2Fe-2S type, ISC system
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_2606: ferredoxin, 2Fe-2S type, ISC system
 
Tolumonas auensis DSM 9187

Gene: Tola_2014: ferredoxin, 2Fe-2S type, ISC system
ferredoxin, 2Fe-2S type, ISC system
yfhJ
 
Psychromonas ingrahamii 37

Gene: Ping_1330: putative Fe-S cluster assembly protein
 
Psychromonas sp. CNPT3

Gene: PCNPT3_05514: putative Fe-S cluster assembly protein
 
Moritella sp. PE36

Gene: PE36_21589: putative Fe-S cluster assembly protein
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
putative Fe-S cluster assembly protein
ASA_2609
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_2609: Hypothetical protein
 
Tolumonas auensis DSM 9187
Hypothetical protein
 
CRON 2.
erpA
*
Psychromonas ingrahamii 37

Site:
position = -65
score = 6.69408
sequence = ATACTTGAACTAATTAGTCAGGTAC

Gene: Ping_0867: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Psychromonas sp. CNPT3

Site:
position = -63
score = 7.09409
sequence = ATAGTTGAACTAATTAGTCGGGTAT

Gene: PCNPT3_04157: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Moritella sp. PE36

Site:
position = -67
score = 7.19272
sequence = ATAGTTGACTGAATTAGTCAGGTAT

Gene: PE36_05088: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -24
score = 6.62404
sequence = ATACTTGAACTGAATGGTCGGGTAT

Gene: AHA_3517: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -78
score = 6.87196
sequence = ATACTTGAACTAAACAGTCGGGTAT

Gene: ASA_0800: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Tolumonas auensis DSM 9187

Site:
position = -94
score = 7.04922
sequence = ATACTTGAACTGTTTAGTCAGGTAT

Gene: Tola_0580: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD