Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog IscR - Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 43 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Pseudoalteromonas atlantica T6c 9 3
Alteromonas macleodii 'Deep ecotype' 10 3
Glaciecola sp. HTCC2999 9 3
Colwellia psychrerythraea 34H 11 4
Alteromonadales bacterium TW-7 11 4
Pseudoalteromonas haloplanktis TAC125 11 4
Pseudoalteromonas tunicata D2 11 4
Idiomarina baltica OS145 10 3
Idiomarina loihiensis L2TR 12 5
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
sufB
 
Pseudoalteromonas atlantica T6c
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -227
score = 6.55192
sequence = ATATTTGAGTGAAATAGTCGGGTAT

Gene: MADE_01357: Iron-sulfur cluster assembly protein SufB
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
*
Idiomarina baltica OS145

Site:
position = -65
score = 5.77568
sequence = AAAGTTGAGTGTTTTACTCGGGTAT

Gene: OS145_02725: Iron-sulfur cluster assembly protein SufB
*
Idiomarina loihiensis L2TR

Site:
position = -86
score = 5.88058
sequence = AAAGTTGAGTGTTTTAGTCAGGTAT

Gene: IL0154: Iron-sulfur cluster assembly protein SufB
Iron-sulfur cluster assembly protein SufB
sufC
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01358: Iron-sulfur cluster assembly ATPase protein SufC
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145

Gene: OS145_02730: Iron-sulfur cluster assembly ATPase protein SufC
 
Idiomarina loihiensis L2TR

Gene: IL0153: Iron-sulfur cluster assembly ATPase protein SufC
Iron-sulfur cluster assembly ATPase protein SufC
sufD
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01359: Iron-sulfur cluster assembly protein SufD
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145

Gene: OS145_02735: Iron-sulfur cluster assembly protein SufD
 
Idiomarina loihiensis L2TR

Gene: IL0152: Iron-sulfur cluster assembly protein SufD
Iron-sulfur cluster assembly protein SufD
sufS
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01360: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145

Gene: OS145_02740: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Idiomarina loihiensis L2TR

Gene: IL0151: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
sufA
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01361: Iron binding protein SufA for iron-sulfur cluster assembly
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145

Gene: OS145_02745: Iron binding protein SufA for iron-sulfur cluster assembly
 
Idiomarina loihiensis L2TR

Gene: IL0150: Iron binding protein SufA for iron-sulfur cluster assembly
Iron binding protein SufA for iron-sulfur cluster assembly
sufT
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01362: Iron sulfur cluster assembly protein SufT
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145

Gene: OS145_02750: Iron sulfur cluster assembly protein SufT
 
Idiomarina loihiensis L2TR

Gene: IL0149: Iron sulfur cluster assembly protein SufT
Iron sulfur cluster assembly protein SufT
sufE
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01363: Sulfur acceptor protein SufE for iron-sulfur cluster assembly
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145

Gene: OS145_02755: Sulfur acceptor protein SufE for iron-sulfur cluster assembly
 
Idiomarina loihiensis L2TR

Gene: IL0148: Sulfur acceptor protein SufE for iron-sulfur cluster assembly
Sulfur acceptor protein SufE for iron-sulfur cluster assembly
 
CRON 2.
erpA
*
Pseudoalteromonas atlantica T6c

Site:
position = -118
score = 6.16214
sequence = ATAGTTGATAAGATTAGTCAGGTAT

Gene: Patl_0544: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01609: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Glaciecola sp. HTCC2999

Site:
position = -66
score = 6.55756
sequence = ATACTTGATGAATTTACTCAAGTAT

Gene: GHTCC_010100001060: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Colwellia psychrerythraea 34H

Site:
position = -101
score = 6.85803
sequence = ATACTTGACTAAAATAGTCAAGTTT

Gene: CPS_4622: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Alteromonadales bacterium TW-7

Site:
position = -62
score = 6.93127
sequence = ATACTTGATTAAAACACTCGGGTAT

Gene: ATW7_10453: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -62
score = 6.93127
sequence = ATACTTGATTAAAACACTCGGGTAT

Gene: PSHAa2251: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Pseudoalteromonas tunicata D2

Site:
position = -62
score = 6.64485
sequence = GTACTTGATTAAAACACTCGGGTAT

Gene: PTD2_12764: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
 
Idiomarina baltica OS145

Gene: OS145_07926: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Idiomarina loihiensis L2TR

Site:
position = -64
score = 6.94214
sequence = ATACTTGACCAAAATACTCAGGTAA

Gene: IL2240: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
 
CRON 3.
nfuA
*
Pseudoalteromonas atlantica T6c

Site:
position = -68
score = 6.09353
sequence = TTACTTGAGTGTTTTAGTCAAGTAA

Gene: Patl_4233: NfuA Fe-S protein maturation
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -69
score = 6.54888
sequence = ATACCTGACTGTTTTAGTCAGGTAA

Gene: MADE_03996: NfuA Fe-S protein maturation
*
Glaciecola sp. HTCC2999

Site:
position = -72
score = 6.73471
sequence = ATACTTGACTGTTTTAGTCGGGTAA

Gene: GHTCC_010100008811: NfuA Fe-S protein maturation
*
Colwellia psychrerythraea 34H

Site:
position = -94
score = 7.11028
sequence = ATACTTGAGTAAAACAGTCAGGTAT

Gene: CPS_0220: NfuA Fe-S protein maturation
*
Alteromonadales bacterium TW-7

Site:
position = -37
score = 6.18931
sequence = GTATCCGAGTAATTTAGTCAGGTAT

Gene: ATW7_17107: NfuA Fe-S protein maturation
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -35
score = 5.99505
sequence = GTATCCGAGTAATTTAGTCAAGTAT

Gene: PSHAa2860: NfuA Fe-S protein maturation
*
Pseudoalteromonas tunicata D2

Site:
position = -35
score = 6.06979
sequence = ATACCCGAGTATTTTAGTCAACTAT

Gene: PTD2_16836: NfuA Fe-S protein maturation
*
Idiomarina baltica OS145

Site:
position = -40
score = 5.16699
sequence = AAAACCTAGTAAATTACTCAAGTAT

Gene: OS145_02245: NfuA Fe-S protein maturation
*
Idiomarina loihiensis L2TR

Site:
position = -45
score = 6.33135
sequence = ATACCCTAGTAATTTACTCAGGTAT

Gene: IL0248: NfuA Fe-S protein maturation
NfuA Fe-S protein maturation
CPS_0221
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H

Gene: CPS_0221: Conserved hypothetical protein
 
Alteromonadales bacterium TW-7

Gene: ATW7_17102: Conserved hypothetical protein
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa2861: Conserved hypothetical protein
 
Pseudoalteromonas tunicata D2

Gene: PTD2_16841: Conserved hypothetical protein
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Conserved hypothetical protein
 
CRON 4.
iscR
*
Pseudoalteromonas atlantica T6c

Site:
position = -87
score = 6.45238
sequence = ATACTTGACTAAAACAGTAGGATAA

Site:
position = -62
score = 7.01621
sequence = ATACTTGACTAAAATAGTCGGGTTT

Gene: Patl_1237: Iron-sulfur cluster regulator IscR
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -88
score = 6.07992
sequence = ATACTTGACTAATTTACTGGGTTTT

Site:
position = -63
score = 6.87461
sequence = ATACTTGACCATTTTAGTCAGGTAT

Gene: MADE_01355: Iron-sulfur cluster regulator IscR
*
Glaciecola sp. HTCC2999

Site:
position = -62
score = 7.28547
sequence = ATACTTGACTAATTTAGTCGGGTAA

Site:
position = -87
score = 6.95097
sequence = ATACTTGACTAAATTAGTCGGTTAA

Gene: GHTCC_010100002924: Iron-sulfur cluster regulator IscR
*
Colwellia psychrerythraea 34H

Site:
position = -199
score = 6.52508
sequence = ATACCTGAGTAAATCACTAGGGTAT

Site:
position = -254
score = 6.26262
sequence = ATAGTTGAGTAAAACAGTCAACTAT

Gene: CPS_1131: Iron-sulfur cluster regulator IscR
*
Alteromonadales bacterium TW-7

Site:
position = -57
score = 6.99178
sequence = ATACTTGACTAATTTACTCTGGTAA

Site:
position = -148
score = 6.02959
sequence = ATACTTGACCAAACAGGTCAGGTAT

Site:
position = -187
score = 7.3039
sequence = ATACTTGACTAAATTACTCAGGTAA

Gene: ATW7_18135: Iron-sulfur cluster regulator IscR
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -58
score = 6.99178
sequence = ATACTTGACTAATTTACTCTGGTAA

Site:
position = -117
score = 7.04145
sequence = ATACTTGAGTAAAACACTCAGGTAT

Site:
position = -157
score = 7.3039
sequence = ATACTTGACTAAATTACTCAGGTAA

Gene: PSHAa2672: Iron-sulfur cluster regulator IscR
*
Pseudoalteromonas tunicata D2

Site:
position = -107
score = 7.33665
sequence = ATACTTGACTAAATTAGTCGGGTAA

Site:
position = -149
score = 7.38783
sequence = ATACTTGACTAAATTAGTCGGGTAT

Site:
position = -66
score = 6.41803
sequence = ATACTTGACTCTTTTAGTCAGGTTA

Gene: PTD2_13944: Iron-sulfur cluster regulator IscR
*
Idiomarina baltica OS145

Site:
position = -75
score = 6.62253
sequence = ATACTTGACTAATTTAGTCGGAAAA

Gene: OS145_04890: Iron-sulfur cluster regulator IscR
*
Idiomarina loihiensis L2TR

Site:
position = -74
score = 6.96874
sequence = ATACTTGACTAAAATAGTCGGGAAT

Gene: IL2041: Iron-sulfur cluster regulator IscR
Iron-sulfur cluster regulator IscR
iscS
 
Pseudoalteromonas atlantica T6c

Gene: Patl_1238: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01356: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100002929: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Colwellia psychrerythraea 34H

Gene: CPS_1132: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Alteromonadales bacterium TW-7

Gene: ATW7_18140: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa2671: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Pseudoalteromonas tunicata D2

Gene: PTD2_13939: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Idiomarina baltica OS145

Gene: OS145_04885: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Idiomarina loihiensis L2TR

Gene: IL2040: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
iscU
 
Pseudoalteromonas atlantica T6c

Gene: Patl_1239: Iron-sulfur cluster assembly scaffold protein IscU
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100002934: Iron-sulfur cluster assembly scaffold protein IscU
 
Colwellia psychrerythraea 34H

Gene: CPS_1133: Iron-sulfur cluster assembly scaffold protein IscU
 
Alteromonadales bacterium TW-7

Gene: ATW7_18145: Iron-sulfur cluster assembly scaffold protein IscU
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa2670: Iron-sulfur cluster assembly scaffold protein IscU
 
Pseudoalteromonas tunicata D2

Gene: PTD2_13934: Iron-sulfur cluster assembly scaffold protein IscU
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Iron-sulfur cluster assembly scaffold protein IscU
iscA
 
Pseudoalteromonas atlantica T6c

Gene: Patl_1240: Iron binding protein IscA for iron-sulfur cluster assembly
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100002939: Iron binding protein IscA for iron-sulfur cluster assembly
 
Colwellia psychrerythraea 34H

Gene: CPS_1134: Iron binding protein IscA for iron-sulfur cluster assembly
 
Alteromonadales bacterium TW-7

Gene: ATW7_18150: Iron binding protein IscA for iron-sulfur cluster assembly
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa2669: Iron binding protein IscA for iron-sulfur cluster assembly
 
Pseudoalteromonas tunicata D2

Gene: PTD2_13929: Iron binding protein IscA for iron-sulfur cluster assembly
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Iron binding protein IscA for iron-sulfur cluster assembly
hscB
 
Pseudoalteromonas atlantica T6c

Gene: Patl_1241: Chaperone protein HscB
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100002944: Chaperone protein HscB
 
Colwellia psychrerythraea 34H

Gene: CPS_1135: Chaperone protein HscB
 
Alteromonadales bacterium TW-7

Gene: ATW7_18155: Chaperone protein HscB
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa2668: Chaperone protein HscB
 
Pseudoalteromonas tunicata D2

Gene: PTD2_13924: Chaperone protein HscB
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Chaperone protein HscB
hscA
 
Pseudoalteromonas atlantica T6c

Gene: Patl_1242: Chaperone protein HscA
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100002949: Chaperone protein HscA
 
Colwellia psychrerythraea 34H

Gene: CPS_1136: Chaperone protein HscA
 
Alteromonadales bacterium TW-7

Gene: ATW7_18160: Chaperone protein HscA
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa2667: Chaperone protein HscA
 
Pseudoalteromonas tunicata D2

Gene: PTD2_13919: Chaperone protein HscA
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Chaperone protein HscA
fdx
 
Pseudoalteromonas atlantica T6c

Gene: Patl_1243: ferredoxin, 2Fe-2S type, ISC system
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100002954: ferredoxin, 2Fe-2S type, ISC system
 
Colwellia psychrerythraea 34H

Gene: CPS_1137: ferredoxin, 2Fe-2S type, ISC system
 
Alteromonadales bacterium TW-7

Gene: ATW7_18165: ferredoxin, 2Fe-2S type, ISC system
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa2666: ferredoxin, 2Fe-2S type, ISC system
 
Pseudoalteromonas tunicata D2

Gene: PTD2_13914: ferredoxin, 2Fe-2S type, ISC system
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
ferredoxin, 2Fe-2S type, ISC system
 
CRON 5.
ydhD
 
Pseudoalteromonas atlantica T6c

Gene: Patl_1396: Probable monothiol glutaredoxin ydhD
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_02749: Probable monothiol glutaredoxin ydhD
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100007517: Probable monothiol glutaredoxin ydhD
*
Colwellia psychrerythraea 34H

Site:
position = -216
score = 6.4683
sequence = AAACTTGAGTAAAATACTCAAGTAT

Gene: CPS_3475: Probable monothiol glutaredoxin ydhD
*
Alteromonadales bacterium TW-7

Site:
position = -162
score = 5.66028
sequence = ATTGTTGAGTATTTTACTCAAGTTT

Gene: ATW7_06868: Probable monothiol glutaredoxin ydhD
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -163
score = 5.31576
sequence = ATTGTTGAGTATTCTACTCAAGTTT

Gene: PSHAa1216: Probable monothiol glutaredoxin ydhD
*
Pseudoalteromonas tunicata D2

Site:
position = -164
score = 4.99413
sequence = AATCCCGAGTATTTTACTCAAGTTT

Gene: PTD2_10759: Probable monothiol glutaredoxin ydhD
 
Idiomarina baltica OS145
*
Idiomarina loihiensis L2TR

Site:
position = -44
score = 5.02314
sequence = ATACCTGAGTGTTTTAATCAACCAT

Gene: IL1804: Probable monothiol glutaredoxin ydhD
Probable monothiol glutaredoxin ydhD
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD