Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog IscR - Pasteurellales

Properties
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 22 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Haemophilus influenzae Rd KW20 10 2
Aggregatibacter aphrophilus NJ8700 11 3
Pasteurella multocida subsp. multocida str. Pm70 10 3
Mannheimia succiniciproducens MBEL55E 12 3
Actinobacillus succinogenes 130Z 11 3
Haemophilus somnus 2336 10 3
Actinobacillus pleuropneumoniae serovar 7 str. AP76 11 2
Haemophilus ducreyi 35000HP 10 2
Haemophilus parasuis SH0165 3 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
erpA
 
Haemophilus influenzae Rd KW20

Gene: HI1723: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Aggregatibacter aphrophilus NJ8700

Site:
position = -67
score = 4.92277
sequence = ATTCTTGAATGCCTTAGAGGGTTAT

Gene: NT05HA_0581: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -65
score = 6.24918
sequence = ATTCTTGAACGAATTAGTCGGTTAT

Gene: PM0458: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -73
score = 5.72663
sequence = TTGGTTGAACGAATTAGTCGGTTAT

Gene: MS1307: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Actinobacillus succinogenes 130Z

Site:
position = -73
score = 5.73569
sequence = ATCCTTGAACGAATCAGTCGGTTAT

Gene: Asuc_1030: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Haemophilus somnus 2336

Site:
position = -64
score = 5.3123
sequence = AATCTTGAATGGTTTGGTTGGTTAT

Gene: HSM_1296: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_1469: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
 
Haemophilus ducreyi 35000HP

Gene: HD0684: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
 
Haemophilus parasuis SH0165

Gene: HAPS_2065: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
yacL
 
Haemophilus influenzae Rd KW20

Gene: HI1724: Conserved hypothetical protein
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_0580: Conserved hypothetical protein
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM0457: Conserved hypothetical protein
 
Mannheimia succiniciproducens MBEL55E

Gene: MS1308: Conserved hypothetical protein
 
Actinobacillus succinogenes 130Z

Gene: Asuc_1029: Conserved hypothetical protein
 
Haemophilus somnus 2336

Gene: HSM_1295: Conserved hypothetical protein
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_1023: Conserved hypothetical protein
 
Haemophilus ducreyi 35000HP

Gene: HD1708: Conserved hypothetical protein
 
Haemophilus parasuis SH0165

Gene: HAPS_0370: Conserved hypothetical protein
Conserved hypothetical protein
 
CRON 2.
nfuA
*
Haemophilus influenzae Rd KW20

Site:
position = -38
score = 4.84189
sequence = ATTCCCGATACTTTCTCTCAAGTAT

Gene: HI0433: NfuA Fe-S protein maturation
*
Aggregatibacter aphrophilus NJ8700

Site:
position = -43
score = 5.25689
sequence = ATGCCCGACAAAATCAATCAAGTTT

Gene: NT05HA_1766: NfuA Fe-S protein maturation
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -46
score = 5.81507
sequence = ATTCTTGACAATCTTACTCAAGTAT

Gene: PM1557: NfuA Fe-S protein maturation
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -59
score = 5.65582
sequence = ATTCCCGACTATGTTAGTCAGCTAT

Gene: MS2232: NfuA Fe-S protein maturation
*
Actinobacillus succinogenes 130Z

Site:
position = -40
score = 4.58466
sequence = ATTTCCGACCGTAAAACTCAGATAA

Gene: Asuc_0296: NfuA Fe-S protein maturation
*
Haemophilus somnus 2336

Site:
position = -43
score = 5.96035
sequence = ATTCCTGATAATTTTACTCAAGTAT

Gene: HSM_0510: NfuA Fe-S protein maturation
*
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Site:
position = -49
score = 5.55584
sequence = ATATCCGATAAATTTAGTCAATTAA

Gene: APP7_0151: NfuA Fe-S protein maturation
*
Haemophilus ducreyi 35000HP

Site:
position = -47
score = 5.5942
sequence = ATGGCTGATAATTTTAGTCAAGTTA

Gene: HD0378: NfuA Fe-S protein maturation
 
Haemophilus parasuis SH0165

Gene: HAPS_1078: NfuA Fe-S protein maturation
NfuA Fe-S protein maturation
 
CRON 3.
iscR
*
Haemophilus influenzae Rd KW20

Site:
position = -60
score = 6.30945
sequence = ATAATTGACTAAATTAGTCAGATAT

Gene: HI0379: Iron-sulfur cluster regulator IscR
*
Aggregatibacter aphrophilus NJ8700

Site:
position = -68
score = 5.21099
sequence = ATAGTTGACTAAACAAGTCAACAAT

Gene: NT05HA_1200: Iron-sulfur cluster regulator IscR
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -69
score = 5.9168
sequence = ATAGTTGACTAATTTAGTATGATAT

Gene: PM0317: Iron-sulfur cluster regulator IscR
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -69
score = 6.16141
sequence = ATAGTTGACTAATTTACTTGGTTAT

Gene: MS1727: Iron-sulfur cluster regulator IscR
*
Actinobacillus succinogenes 130Z

Site:
position = -64
score = 5.95617
sequence = ATAGTTGATTAATTTGGTTGGTTAT

Gene: Asuc_0863: Iron-sulfur cluster regulator IscR
*
Haemophilus somnus 2336

Site:
position = -65
score = 5.24966
sequence = GAAGTTGACTAATTTAGTAGGATTA

Gene: HSM_0153: Iron-sulfur cluster regulator IscR
*
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Site:
position = -83
score = 5.94631
sequence = ATTCTTGACTGTAACAGTCAGGTAT

Gene: APP7_0990: Iron-sulfur cluster regulator IscR
*
Haemophilus ducreyi 35000HP

Site:
position = -75
score = 6.17607
sequence = ATGCTTGACTAAAATAGTCGAGTAT

Gene: HD1080: Iron-sulfur cluster regulator IscR
*
Haemophilus parasuis SH0165

Site:
position = -70
score = 5.99586
sequence = AATATTGACTAAATTAGTAGGGTAT

Gene: HAPS_0052: Iron-sulfur cluster regulator IscR
Iron-sulfur cluster regulator IscR
iscS
 
Haemophilus influenzae Rd KW20

Gene: HI0378: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_1201: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM0318: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Mannheimia succiniciproducens MBEL55E

Gene: MS1726: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Actinobacillus succinogenes 130Z

Gene: Asuc_0864: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Haemophilus somnus 2336

Gene: HSM_0154: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_0989: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Haemophilus ducreyi 35000HP

Gene: HD1082: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Haemophilus parasuis SH0165

Gene: HAPS_0053: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
iscU
 
Haemophilus influenzae Rd KW20

Gene: HI0377: Iron-sulfur cluster assembly scaffold protein IscU
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_1202: Iron-sulfur cluster assembly scaffold protein IscU
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM0319: Iron-sulfur cluster assembly scaffold protein IscU
 
Mannheimia succiniciproducens MBEL55E

Gene: MS1724: Iron-sulfur cluster assembly scaffold protein IscU
 
Actinobacillus succinogenes 130Z

Gene: Asuc_0865: Iron-sulfur cluster assembly scaffold protein IscU
 
Haemophilus somnus 2336

Gene: HSM_0155: Iron-sulfur cluster assembly scaffold protein IscU
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_0988: Iron-sulfur cluster assembly scaffold protein IscU
 
Haemophilus ducreyi 35000HP

Gene: HD1083: Iron-sulfur cluster assembly scaffold protein IscU
 
Haemophilus parasuis SH0165

Gene: HAPS_0054: Iron-sulfur cluster assembly scaffold protein IscU
Iron-sulfur cluster assembly scaffold protein IscU
iscA
 
Haemophilus influenzae Rd KW20

Gene: HI0376: Iron binding protein IscA for iron-sulfur cluster assembly
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_1203: Iron binding protein IscA for iron-sulfur cluster assembly
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM0320: Iron binding protein IscA for iron-sulfur cluster assembly
 
Mannheimia succiniciproducens MBEL55E

Gene: MS1723: Iron binding protein IscA for iron-sulfur cluster assembly
 
Actinobacillus succinogenes 130Z

Gene: Asuc_0866: Iron binding protein IscA for iron-sulfur cluster assembly
 
Haemophilus somnus 2336

Gene: HSM_0156: Iron binding protein IscA for iron-sulfur cluster assembly
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_0987: Iron binding protein IscA for iron-sulfur cluster assembly
 
Haemophilus ducreyi 35000HP

Gene: HD1084: Iron binding protein IscA for iron-sulfur cluster assembly
 
Haemophilus parasuis SH0165

Gene: HAPS_0055: Iron binding protein IscA for iron-sulfur cluster assembly
Iron binding protein IscA for iron-sulfur cluster assembly
hscB
 
Haemophilus influenzae Rd KW20

Gene: HI0375: Chaperone protein HscB
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_1204: Chaperone protein HscB
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM0321: Chaperone protein HscB
 
Mannheimia succiniciproducens MBEL55E

Gene: MS1722: Chaperone protein HscB
 
Actinobacillus succinogenes 130Z

Gene: Asuc_0867: Chaperone protein HscB
 
Haemophilus somnus 2336

Gene: HSM_0157: Chaperone protein HscB
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_0986: Chaperone protein HscB
 
Haemophilus ducreyi 35000HP

Gene: HD1085: Chaperone protein HscB
 
Haemophilus parasuis SH0165

Gene: HAPS_0056: Chaperone protein HscB
Chaperone protein HscB
NT05HA_2059
 
Haemophilus influenzae Rd KW20
 
Aggregatibacter aphrophilus NJ8700
 
Pasteurella multocida subsp. multocida str. Pm70
 
Mannheimia succiniciproducens MBEL55E
 
Actinobacillus succinogenes 130Z
 
Haemophilus somnus 2336
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_0985: Conserved hypothetical protein
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165
Conserved hypothetical protein
DUF2625
 
Haemophilus influenzae Rd KW20

Gene: HI0374: conserved hypothetical protein, DUF2625
 
Aggregatibacter aphrophilus NJ8700
 
Pasteurella multocida subsp. multocida str. Pm70
 
Mannheimia succiniciproducens MBEL55E
 
Actinobacillus succinogenes 130Z
 
Haemophilus somnus 2336
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_0984: conserved hypothetical protein, DUF2625
 
Haemophilus ducreyi 35000HP

Gene: HD1086: conserved hypothetical protein, DUF2625
 
Haemophilus parasuis SH0165

Gene: HAPS_0058: conserved hypothetical protein, DUF2625
conserved hypothetical protein, DUF2625
hscA
 
Haemophilus influenzae Rd KW20

Gene: HI0373: Chaperone protein HscA
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_1205: Chaperone protein HscA
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM0322: Chaperone protein HscA
 
Mannheimia succiniciproducens MBEL55E

Gene: MS1721: Chaperone protein HscA
 
Actinobacillus succinogenes 130Z

Gene: Asuc_0868: Chaperone protein HscA
 
Haemophilus somnus 2336

Gene: HSM_0158: Chaperone protein HscA
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_0983: Chaperone protein HscA
 
Haemophilus ducreyi 35000HP

Gene: HD1087: Chaperone protein HscA
 
Haemophilus parasuis SH0165

Gene: HAPS_0059: Chaperone protein HscA
Chaperone protein HscA
fdx
 
Haemophilus influenzae Rd KW20

Gene: HI0372: ferredoxin, 2Fe-2S type, ISC system
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_1206: ferredoxin, 2Fe-2S type, ISC system
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM0323: ferredoxin, 2Fe-2S type, ISC system
 
Mannheimia succiniciproducens MBEL55E

Gene: MS1720: ferredoxin, 2Fe-2S type, ISC system
 
Actinobacillus succinogenes 130Z

Gene: Asuc_0869: ferredoxin, 2Fe-2S type, ISC system
 
Haemophilus somnus 2336

Gene: HSM_0159: ferredoxin, 2Fe-2S type, ISC system
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_0982: ferredoxin, 2Fe-2S type, ISC system
 
Haemophilus ducreyi 35000HP

Gene: HD1088: ferredoxin, 2Fe-2S type, ISC system
 
Haemophilus parasuis SH0165

Gene: HAPS_0060: ferredoxin, 2Fe-2S type, ISC system
ferredoxin, 2Fe-2S type, ISC system
yfhJ
 
Haemophilus influenzae Rd KW20

Gene: HI0371: putative Fe-S cluster assembly protein
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_1207: putative Fe-S cluster assembly protein
 
Pasteurella multocida subsp. multocida str. Pm70
 
Mannheimia succiniciproducens MBEL55E

Gene: MS1719: putative Fe-S cluster assembly protein
 
Actinobacillus succinogenes 130Z

Gene: Asuc_0870: putative Fe-S cluster assembly protein
 
Haemophilus somnus 2336
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_0981: putative Fe-S cluster assembly protein
 
Haemophilus ducreyi 35000HP

Gene: HD1089: putative Fe-S cluster assembly protein
 
Haemophilus parasuis SH0165

Gene: HAPS_0061: putative Fe-S cluster assembly protein
putative Fe-S cluster assembly protein
MS1725
 
Haemophilus influenzae Rd KW20
 
Aggregatibacter aphrophilus NJ8700
 
Pasteurella multocida subsp. multocida str. Pm70
 
Mannheimia succiniciproducens MBEL55E

Gene: MS1725: Hypothetical protein
 
Actinobacillus succinogenes 130Z
 
Haemophilus somnus 2336
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165
Hypothetical protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD