Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog IscR - Vibrionales

Properties
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 39 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Vibrio cholerae O1 biovar eltor str. N16961 10 3
Vibrio vulnificus CMCP6 10 3
Vibrio harveyi ATCC BAA-1116 10 3
Vibrio parahaemolyticus RIMD 2210633 10 3
Vibrio shilonii AK1 10 3
Vibrio splendidus LGP32 9 2
Vibrio fischeri ES114 10 3
Vibrio salmonicida LFI1238 10 3
Vibrio angustum S14 10 3
Photobacterium profundum SS9 10 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
erpA
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -114
score = 5.24488
sequence = ATACTTGAACGGCCAACTCAGGTAT

Gene: VC0627: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Vibrio vulnificus CMCP6

Site:
position = -175
score = 6.86147
sequence = ATACTTGAACGTATTGGTCAGGTAT

Gene: VV1_1679: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -87
score = 6.70416
sequence = ATACTTGAACGAGTTTGTCAGGTAT

Gene: VIBHAR_03416: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -103
score = 6.70416
sequence = ATACTTGAACGAGTTTGTCAGGTAT

Gene: VP2474: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Vibrio shilonii AK1

Site:
position = -169
score = 6.69545
sequence = ATACTTGAACGAAGCAGTCAGGTAT

Gene: VSAK1_05110: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Vibrio splendidus LGP32

Site:
position = -87
score = 6.82803
sequence = ATACTTGAACGTTTCAGTCAGGTAT

Gene: VS_2501: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Vibrio fischeri ES114

Site:
position = -75
score = 6.95769
sequence = ATACTTGAATGAAACAGTCAGGTAT

Gene: VF_2134: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Vibrio salmonicida LFI1238

Site:
position = -75
score = 6.95769
sequence = ATACTTGAATGAAACAGTCAGGTAT

Gene: VSAL_I2571: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Vibrio angustum S14

Site:
position = -68
score = 7.00705
sequence = ATACTTGAACAACATAGTCAGGTAT

Gene: VAS14_07789: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Photobacterium profundum SS9

Site:
position = -68
score = 7.13274
sequence = ATACTTGAACAAGTTAGTCAGGTAT

Gene: PBPRA0531: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
 
CRON 2.
iscR
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -23
score = 6.88847
sequence = ATACTTGACCAAAAGAGTCAAGTAT

Site:
position = -48
score = 6.88519
sequence = ATACCTGACTAAATTAGTCAAATAA

Gene: VC0747: Iron-sulfur cluster regulator IscR
*
Vibrio vulnificus CMCP6

Site:
position = -93
score = 6.70813
sequence = ATACCTGACTATTTTAGTCAAATAA

Site:
position = -68
score = 7.02961
sequence = ATACTTGACCATTTTGGTCAGGTAT

Gene: VV1_0439: Iron-sulfur cluster regulator IscR
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -93
score = 6.86587
sequence = ATACCTGACTAAAATAGTCAAATAA

Site:
position = -68
score = 6.7275
sequence = ATACTTGACCGTTTTGGTCGGGTAT

Gene: VIBHAR_01054: Iron-sulfur cluster regulator IscR
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -93
score = 6.49644
sequence = ATACCTGAGTAATTTAGTCAAATAA

Site:
position = -68
score = 6.68394
sequence = ATACTTGACCATTTTACTCGGGTAT

Gene: VP0595: Iron-sulfur cluster regulator IscR
*
Vibrio shilonii AK1

Site:
position = -91
score = 6.70813
sequence = ATACCTGACTATTTTAGTCAAATAA

Site:
position = -66
score = 7.04713
sequence = ATACTTGATTAAAATAGTCAGGTAT

Gene: VSAK1_12120: Iron-sulfur cluster regulator IscR
*
Vibrio splendidus LGP32

Site:
position = -92
score = 6.65696
sequence = ATACCTGACTAAAATAGTCAACTAA

Site:
position = -67
score = 7.20203
sequence = ATACTTGACCAATTTAGTCGGGTAT

Gene: VS_0606: Iron-sulfur cluster regulator IscR
*
Vibrio fischeri ES114

Site:
position = -69
score = 7.40966
sequence = ATACTTGACCAAAATAGTCAGGTAT

Site:
position = -94
score = 6.30175
sequence = GTACTTGACTAAAATAGTAGGATAA

Gene: VF_0616: Iron-sulfur cluster regulator IscR
*
Vibrio salmonicida LFI1238

Site:
position = -69
score = 7.18734
sequence = ATACTTGACCAAAATGGTCAGGTAT

Site:
position = -94
score = 6.69708
sequence = ATACTTGACTAAAATAGTAGGATAA

Gene: VSAL_I0716: Iron-sulfur cluster regulator IscR
*
Vibrio angustum S14

Site:
position = -103
score = 6.73401
sequence = ATACTTGACCAATTTAGTATGGTAT

Site:
position = -128
score = 5.82461
sequence = ATACCCTACTAGAACAGTCAGGTAA

Gene: VAS14_06718: Iron-sulfur cluster regulator IscR
*
Photobacterium profundum SS9

Site:
position = -66
score = 7.07927
sequence = ATACTTGACCATTTTAGTCGGGTAT

Site:
position = -91
score = 6.4083
sequence = AAACCTGACTAAAATCGTCAGGTAA

Gene: PBPRA0749: Iron-sulfur cluster regulator IscR
Iron-sulfur cluster regulator IscR
iscS
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC0748: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Vibrio vulnificus CMCP6

Gene: VV1_0438: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_01055: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP0596: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Vibrio shilonii AK1

Gene: VSAK1_12115: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Vibrio splendidus LGP32

Gene: VS_0607: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Vibrio fischeri ES114

Gene: VF_0617: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Vibrio salmonicida LFI1238

Gene: VSAL_I0717: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Vibrio angustum S14

Gene: VAS14_06713: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Photobacterium profundum SS9

Gene: PBPRA0750: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
iscU
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC0749: Iron-sulfur cluster assembly scaffold protein IscU
 
Vibrio vulnificus CMCP6

Gene: VV1_0437: Iron-sulfur cluster assembly scaffold protein IscU
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_01056: Iron-sulfur cluster assembly scaffold protein IscU
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP0597: Iron-sulfur cluster assembly scaffold protein IscU
 
Vibrio shilonii AK1

Gene: VSAK1_12110: Iron-sulfur cluster assembly scaffold protein IscU
 
Vibrio splendidus LGP32

Gene: VS_0608: Iron-sulfur cluster assembly scaffold protein IscU
 
Vibrio fischeri ES114

Gene: VF_0618: Iron-sulfur cluster assembly scaffold protein IscU
 
Vibrio salmonicida LFI1238

Gene: VSAL_I0718: Iron-sulfur cluster assembly scaffold protein IscU
 
Vibrio angustum S14

Gene: VAS14_06708: Iron-sulfur cluster assembly scaffold protein IscU
 
Photobacterium profundum SS9

Gene: PBPRA0751: Iron-sulfur cluster assembly scaffold protein IscU
Iron-sulfur cluster assembly scaffold protein IscU
iscA
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC0750: Iron binding protein IscA for iron-sulfur cluster assembly
 
Vibrio vulnificus CMCP6

Gene: VV1_0436: Iron binding protein IscA for iron-sulfur cluster assembly
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_01057: Iron binding protein IscA for iron-sulfur cluster assembly
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP0598: Iron binding protein IscA for iron-sulfur cluster assembly
 
Vibrio shilonii AK1

Gene: VSAK1_12105: Iron binding protein IscA for iron-sulfur cluster assembly
 
Vibrio splendidus LGP32

Gene: VS_0609: Iron binding protein IscA for iron-sulfur cluster assembly
 
Vibrio fischeri ES114

Gene: VF_0619: Iron binding protein IscA for iron-sulfur cluster assembly
 
Vibrio salmonicida LFI1238

Gene: VSAL_I0719: Iron binding protein IscA for iron-sulfur cluster assembly
 
Vibrio angustum S14

Gene: VAS14_06703: Iron binding protein IscA for iron-sulfur cluster assembly
 
Photobacterium profundum SS9

Gene: PBPRA0752: Iron binding protein IscA for iron-sulfur cluster assembly
Iron binding protein IscA for iron-sulfur cluster assembly
hscB
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC0751: Chaperone protein HscB
 
Vibrio vulnificus CMCP6

Gene: VV1_0435: Chaperone protein HscB
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_01058: Chaperone protein HscB
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP0599: Chaperone protein HscB
 
Vibrio shilonii AK1

Gene: VSAK1_12100: Chaperone protein HscB
 
Vibrio splendidus LGP32

Gene: VS_0610: Chaperone protein HscB
 
Vibrio fischeri ES114

Gene: VF_0620: Chaperone protein HscB
 
Vibrio salmonicida LFI1238

Gene: VSAL_I0720: Chaperone protein HscB
 
Vibrio angustum S14

Gene: VAS14_06698: Chaperone protein HscB
 
Photobacterium profundum SS9

Gene: PBPRA0753: Chaperone protein HscB
Chaperone protein HscB
hscA
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC0752: Chaperone protein HscA
 
Vibrio vulnificus CMCP6

Gene: VV1_0434: Chaperone protein HscA
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_01059: Chaperone protein HscA
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP0600: Chaperone protein HscA
 
Vibrio shilonii AK1

Gene: VSAK1_12095: Chaperone protein HscA
 
Vibrio splendidus LGP32

Gene: VS_0611: Chaperone protein HscA
 
Vibrio fischeri ES114

Gene: VF_0621: Chaperone protein HscA
 
Vibrio salmonicida LFI1238

Gene: VSAL_I0721: Chaperone protein HscA
 
Vibrio angustum S14

Gene: VAS14_06693: Chaperone protein HscA
 
Photobacterium profundum SS9

Gene: PBPRA0754: Chaperone protein HscA
Chaperone protein HscA
fdx
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC0753: ferredoxin, 2Fe-2S type, ISC system
 
Vibrio vulnificus CMCP6

Gene: VV1_0433: ferredoxin, 2Fe-2S type, ISC system
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_01060: ferredoxin, 2Fe-2S type, ISC system
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP0601: ferredoxin, 2Fe-2S type, ISC system
 
Vibrio shilonii AK1

Gene: VSAK1_12090: ferredoxin, 2Fe-2S type, ISC system
 
Vibrio splendidus LGP32

Gene: VS_0612: ferredoxin, 2Fe-2S type, ISC system
 
Vibrio fischeri ES114

Gene: VF_0622: ferredoxin, 2Fe-2S type, ISC system
 
Vibrio salmonicida LFI1238

Gene: VSAL_I0722: ferredoxin, 2Fe-2S type, ISC system
 
Vibrio angustum S14

Gene: VAS14_06688: ferredoxin, 2Fe-2S type, ISC system
 
Photobacterium profundum SS9

Gene: PBPRA0755: ferredoxin, 2Fe-2S type, ISC system
ferredoxin, 2Fe-2S type, ISC system
yfhJ
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC0754: putative Fe-S cluster assembly protein
 
Vibrio vulnificus CMCP6

Gene: VV1_0432: putative Fe-S cluster assembly protein
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_01061: putative Fe-S cluster assembly protein
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP0602: putative Fe-S cluster assembly protein
 
Vibrio shilonii AK1

Gene: VSAK1_12085: putative Fe-S cluster assembly protein
 
Vibrio splendidus LGP32

Gene: VS_0613: putative Fe-S cluster assembly protein
 
Vibrio fischeri ES114

Gene: VF_0623: putative Fe-S cluster assembly protein
 
Vibrio salmonicida LFI1238

Gene: VSAL_I0723: putative Fe-S cluster assembly protein
 
Vibrio angustum S14

Gene: VAS14_06683: putative Fe-S cluster assembly protein
 
Photobacterium profundum SS9

Gene: PBPRA0756: putative Fe-S cluster assembly protein
putative Fe-S cluster assembly protein
 
CRON 3.
nfuA
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -30
score = 4.58809
sequence = ATAACCTATTCTTTTACTCAGGTAT

Gene: VC2720: NfuA Fe-S protein maturation
*
Vibrio vulnificus CMCP6

Site:
position = 9
score = 4.93791
sequence = ATAACCTACAAATTTACTCGGGTAT

Gene: VV1_0864: NfuA Fe-S protein maturation
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -30
score = 5.11056
sequence = ATAGCCTACAAATTTACTCAGGTAT

Gene: VIBHAR_00614: NfuA Fe-S protein maturation
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -30
score = 4.76952
sequence = GTAACCTACAAAATTACTCAGGTAT

Gene: VP0146: NfuA Fe-S protein maturation
*
Vibrio shilonii AK1

Site:
position = 6
score = 4.62733
sequence = ATAACCTACAACTATACTCAGGTAT

Gene: VSAK1_13428: NfuA Fe-S protein maturation
 
Vibrio splendidus LGP32

Gene: VS_0148: NfuA Fe-S protein maturation
*
Vibrio fischeri ES114

Site:
position = -30
score = 4.94481
sequence = TAATCATACTAAATTAGTCAGGTAT

Gene: VF_2461: NfuA Fe-S protein maturation
*
Vibrio salmonicida LFI1238

Site:
position = -30
score = 4.89051
sequence = TAATCATACTAATTTAGTCAGGTAT

Gene: VSAL_I2911: NfuA Fe-S protein maturation
*
Vibrio angustum S14

Site:
position = -37
score = 5.14505
sequence = AAAACTCACTAAATAGGTCAGGTAT

Gene: VAS14_21772: NfuA Fe-S protein maturation
*
Photobacterium profundum SS9

Site:
position = -37
score = 5.26008
sequence = AAATCTTACTAAATAGGTCAGGTAT

Gene: PBPRA0177: NfuA Fe-S protein maturation
NfuA Fe-S protein maturation
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD