Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HutC - Comamonadaceae

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 24 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acidovorax avenae subsp. citrulli AAC00-1 11 2
Acidovorax sp. JS42
Comamonas testosteroni KF-1 8 4
Delftia acidovorans SPH-1 13 3
Polaromonas naphthalenivorans CJ2
Polaromonas sp. JS666 27 6
Rhodoferax ferrireducens DSM 15236 8 1
Variovorax paradoxus S110 13 2
Verminephrobacter eiseniae EF01-2 10 1
Methylibium petroleiphilum PM1
Leptothrix cholodnii SP-6
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
hisT
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
*
Delftia acidovorans SPH-1

Site:
position = -449
score = 5.15069
sequence = CATATTGTATATACAGGCTT

Gene: Daci_0094: Histidine transport protein (permease)
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Histidine transport protein (permease)
 
CRON 2.
COG1732 (OpuBC)
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
*
Polaromonas sp. JS666

Site:
position = -158
score = 5.26867
sequence = TCGCTTGTATATACAAGTTG

Gene: Bpro_1158: ABC proline/glycine/betaine transporter, periplasmic binding domain
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
ABC proline/glycine/betaine transporter, periplasmic binding domain
hutH2
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666

Gene: Bpro_1157: Histidine ammonia-lyase (EC 4.3.1.3)
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Histidine ammonia-lyase (EC 4.3.1.3)
COG1174 (OpuBB)
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 2
Polaromonas sp. JS666

Gene: Bpro_1155: ABC proline/glycine/betaine transporter, permease component

Gene: Bpro_1156: ABC proline/glycine/betaine transporter, permease component
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
ABC proline/glycine/betaine transporter, permease component
COG1125 (OpuBA)
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666

Gene: Bpro_1154: ABC proline/glycine/betaine transporter, ATPase component
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
ABC proline/glycine/betaine transporter, ATPase component
 
CRON 3.
hutC
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
*
Comamonas testosteroni KF-1

Site:
position = -80
score = 4.88486
sequence = AAAGTTGTCTATACGAATTT

Gene: CtesDRAFT_4040: Histidine utilization repressor, GntR family
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Histidine utilization repressor, GntR family
 
CRON 4.
hisX
*
Acidovorax avenae subsp. citrulli AAC00-1

Site:
position = -85
score = 5.09304
sequence = AACCCTGTATAGACAGCATG

Gene: Aave_2969: Putative histidine ABC transporter, periplasmic substrate-binding protein
 
Acidovorax sp. JS42
*
Comamonas testosteroni KF-1

Site:
position = -117
score = 5.13435
sequence = AAGCCTGTATATACATGTTC

Site:
position = -164
score = 4.45239
sequence = ATGCATGTCTATACAGCTGT

Gene: CtesDRAFT_4035: Putative histidine ABC transporter, periplasmic substrate-binding protein
*
Delftia acidovorans SPH-1

Site:
position = -217
score = 5.01887
sequence = CAGGTTGTATGGACAAGCTT

Site:
position = -115
score = 5.11005
sequence = AATCCTGTATATACATGTCC

Gene: Daci_0145: Putative histidine ABC transporter, periplasmic substrate-binding protein
 
Polaromonas naphthalenivorans CJ2
*
Polaromonas sp. JS666

Site:
position = -109
score = 5.44403
sequence = TTACCTGTATATACAGGTTG

Site:
position = -231
score = 4.72002
sequence = ATACCTGTATAGACAGCGCA

Gene: Bpro_1047: Putative histidine ABC transporter, periplasmic substrate-binding protein
 
Rhodoferax ferrireducens DSM 15236
*
Variovorax paradoxus S110

Site:
position = -176
score = 5.06279
sequence = CTTCCTGTATAGACAGCAAT

Site:
position = -110
score = 5.69602
sequence = TATCCTGTATATACAAGTTG

Gene: Vapar_0154: Putative histidine ABC transporter, periplasmic substrate-binding protein
*
Verminephrobacter eiseniae EF01-2

Site:
position = -100
score = 5.35556
sequence = CAACCTGTATAGACAGGAAT

Gene: Veis_3641: Putative histidine ABC transporter, periplasmic substrate-binding protein
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Putative histidine ABC transporter, periplasmic substrate-binding protein
hisY
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2968: Putative histidine ABC transporter, permease protein
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_4036: Putative histidine ABC transporter, permease protein
 
Delftia acidovorans SPH-1

Gene: Daci_0146: Putative histidine ABC transporter, permease protein
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666

Gene: Bpro_1046: Putative histidine ABC transporter, permease protein
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_0155: Putative histidine ABC transporter, permease protein
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_3642: Putative histidine ABC transporter, permease protein
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Putative histidine ABC transporter, permease protein
hisZ
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2967: Putative histidine ABC transporter, ATP-binding protein
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_4037: Putative histidine ABC transporter, ATP-binding protein
 
Delftia acidovorans SPH-1

Gene: Daci_0147: Putative histidine ABC transporter, ATP-binding protein
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666

Gene: Bpro_1045: Putative histidine ABC transporter, ATP-binding protein
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_0156: Putative histidine ABC transporter, ATP-binding protein
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_3643: Putative histidine ABC transporter, ATP-binding protein
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Putative histidine ABC transporter, ATP-binding protein
hutC
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2966: Histidine utilization repressor, GntR family
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_4038: Histidine utilization repressor, GntR family
 
Delftia acidovorans SPH-1

Gene: Daci_0148: Histidine utilization repressor, GntR family
 
Polaromonas naphthalenivorans CJ2
*2
Polaromonas sp. JS666

Gene: Bpro_1044: Histidine utilization repressor, GntR family

Site:
position = -98
score = 5.70955
sequence = GTAGTTGTCTATACAACTTG

Gene: Bpro_1165: Histidine utilization repressor, GntR family
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_4157: Histidine utilization repressor, GntR family
 
Variovorax paradoxus S110

Gene: Vapar_0157: Histidine utilization repressor, GntR family
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_3644: Histidine utilization repressor, GntR family
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Histidine utilization repressor, GntR family
hutH
*
Acidovorax avenae subsp. citrulli AAC00-1

Site:
position = -24
score = 5.2384
sequence = TGACTTGTATATACAGGAAA

Site:
position = -102
score = 5.63605
sequence = CAGCCTGTATATACAAGTTG

Gene: Aave_2965: Histidine ammonia-lyase (EC 4.3.1.3)
 
Acidovorax sp. JS42
*
Comamonas testosteroni KF-1

Site:
position = -24
score = 4.55643
sequence = TTGACTGTATAGACAGGTAT

Gene: CtesDRAFT_4039: Histidine ammonia-lyase (EC 4.3.1.3)
*
Delftia acidovorans SPH-1

Site:
position = -67
score = 4.86688
sequence = GATATTGTATAGACAGGCAT

Gene: Daci_0149: Histidine ammonia-lyase (EC 4.3.1.3)
 
Polaromonas naphthalenivorans CJ2
*2
Polaromonas sp. JS666

Site:
position = -25
score = 5.57679
sequence = CAACTTGTATATACAGGACT

Gene: Bpro_1043: Histidine ammonia-lyase (EC 4.3.1.3)

Gene: Bpro_1160: Histidine ammonia-lyase (EC 4.3.1.3)
 
Rhodoferax ferrireducens DSM 15236
*
Variovorax paradoxus S110

Site:
position = -22
score = 5.57762
sequence = CTACTTGTATAGACAGGTTC

Gene: Vapar_0158: Histidine ammonia-lyase (EC 4.3.1.3)
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_3645: Histidine ammonia-lyase (EC 4.3.1.3)
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Histidine ammonia-lyase (EC 4.3.1.3)
hutU
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2964: Urocanate hydratase (EC 4.2.1.49)
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_4042: Urocanate hydratase (EC 4.2.1.49)
 
Delftia acidovorans SPH-1

Gene: Daci_0150: Urocanate hydratase (EC 4.2.1.49)
 
Polaromonas naphthalenivorans CJ2
*2
Polaromonas sp. JS666

Gene: Bpro_1042: Urocanate hydratase (EC 4.2.1.49)

Site:
position = -99
score = 5.70955
sequence = CAAGTTGTATAGACAACTAC

Gene: Bpro_1164: Urocanate hydratase (EC 4.2.1.49)
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_0159: Urocanate hydratase (EC 4.2.1.49)
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_3646: Urocanate hydratase (EC 4.2.1.49)
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Urocanate hydratase (EC 4.2.1.49)
hutD
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2962: Conserved hypothetical protein related to histidine degradation
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_4043: Conserved hypothetical protein related to histidine degradation
 
Delftia acidovorans SPH-1

Gene: Daci_0151: Conserved hypothetical protein related to histidine degradation
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666

Gene: Bpro_1036: Conserved hypothetical protein related to histidine degradation
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_4156: Conserved hypothetical protein related to histidine degradation
 
Variovorax paradoxus S110

Gene: Vapar_0163: Conserved hypothetical protein related to histidine degradation
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_3647: Conserved hypothetical protein related to histidine degradation
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6

Gene: Lcho_0164: Conserved hypothetical protein related to histidine degradation
Conserved hypothetical protein related to histidine degradation
hutI
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2961: Imidazolonepropionase (EC 3.5.2.7)
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_4044: Imidazolonepropionase (EC 3.5.2.7)
 
Delftia acidovorans SPH-1

Gene: Daci_0152: Imidazolonepropionase (EC 3.5.2.7)
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666

Gene: Bpro_1035: Imidazolonepropionase (EC 3.5.2.7)
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_0164: Imidazolonepropionase (EC 3.5.2.7)
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_3648: Imidazolonepropionase (EC 3.5.2.7)
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Imidazolonepropionase (EC 3.5.2.7)
hutF
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2960: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_4047: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
 
Delftia acidovorans SPH-1

Gene: Daci_0155: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666

Gene: Bpro_1034: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_4154: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
 
Variovorax paradoxus S110

Gene: Vapar_0165: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_3649: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Formiminoglutamic iminohydrolase (EC 3.5.3.13)
hutG
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2959: N-formylglutamate deformylase (EC 3.5.1.68)
 
Acidovorax sp. JS42

Gene: Ajs_1666: N-formylglutamate deformylase (EC 3.5.1.68)
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_4204: N-formylglutamate deformylase (EC 3.5.1.68)
 
Delftia acidovorans SPH-1

Gene: Daci_0156: N-formylglutamate deformylase (EC 3.5.1.68)
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666

Gene: Bpro_1166: N-formylglutamate deformylase (EC 3.5.1.68)
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_4155: N-formylglutamate deformylase (EC 3.5.1.68)
 
Variovorax paradoxus S110

Gene: Vapar_0166: N-formylglutamate deformylase (EC 3.5.1.68)
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_3650: N-formylglutamate deformylase (EC 3.5.1.68)
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
N-formylglutamate deformylase (EC 3.5.1.68)
COG1414
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_1440: Transcriptional regulator, IclR family
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666

Gene: Bpro_1041: Transcriptional regulator, IclR family
*
Rhodoferax ferrireducens DSM 15236

Site:
position = -221
score = 5.82782
sequence = AAAGTTGTCTATACAACTTA

Gene: Rfer_4161: Transcriptional regulator, IclR family
 
Variovorax paradoxus S110

Gene: Vapar_0160: Transcriptional regulator, IclR family
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Transcriptional regulator, IclR family
COG834 (HisJ)
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666

Gene: Bpro_1040: ABC amino acid transporter, periplasmic binding protein
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_4160: ABC amino acid transporter, periplasmic binding protein
 
Variovorax paradoxus S110

Gene: Vapar_0161: ABC amino acid transporter, periplasmic binding protein
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_3016: ABC amino acid transporter, periplasmic binding protein
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
ABC amino acid transporter, periplasmic binding protein
COG765 (HisM)
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666

Gene: Bpro_1039: ABC amino acid transporter, permease component
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_4159: ABC amino acid transporter, permease component
 
Variovorax paradoxus S110

Gene: Vapar_0162: ABC amino acid transporter, permease component
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_3015: ABC amino acid transporter, permease component
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
ABC amino acid transporter, permease component
COG1126 (GlnQ)
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666

Gene: Bpro_1038: ABC amino acid transporter, ATPase component
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_4158: ABC amino acid transporter, ATPase component
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_3014: ABC amino acid transporter, ATPase component
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
ABC amino acid transporter, ATPase component
COG5285
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2963: Phytanoyl-CoA dioxygenase
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666

Gene: Bpro_1037: Phytanoyl-CoA dioxygenase
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Phytanoyl-CoA dioxygenase
COG277 (GlcD)
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_4045: FAD linked oxidase domain protein
 
Delftia acidovorans SPH-1

Gene: Daci_0153: FAD linked oxidase domain protein
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
FAD linked oxidase domain protein
hisC
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_4046: Histidinol-phosphate aminotransferase
 
Delftia acidovorans SPH-1

Gene: Daci_0154: Histidinol-phosphate aminotransferase
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Histidinol-phosphate aminotransferase
COG2423
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 2
Polaromonas sp. JS666

Gene: Bpro_5200: Predicted ornithine cyclodeaminase, mu-crystallin homolog (EC 4.3.1.12)

Gene: Bpro_1163: Predicted ornithine cyclodeaminase, mu-crystallin homolog (EC 4.3.1.12)
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Predicted ornithine cyclodeaminase, mu-crystallin homolog (EC 4.3.1.12)
COG3221 (PhnD)
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666

Gene: Bpro_1162: ABC phosphate/phosphonate transporter, periplasmic binding component
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
ABC phosphate/phosphonate transporter, periplasmic binding component
COG3181
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666

Gene: Bpro_1161: Uncharacterized conserved putative exported protein
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Uncharacterized conserved putative exported protein
COG1457 (CodB)
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
*
Comamonas testosteroni KF-1

Site:
position = -85
score = 4.88486
sequence = AAATTCGTATAGACAACTTT

Gene: CtesDRAFT_4041: Permease, cytosine/purines, uracil, thiamine, allantoin family protein
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Permease, cytosine/purines, uracil, thiamine, allantoin family protein
 
CRON 5.
COG2855
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_4024: Predicted membrane protein
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
*
Polaromonas sp. JS666

Site:
position = -120
score = 5.26867
sequence = CAACTTGTATATACAAGCGA

Gene: Bpro_1159: Predicted membrane protein
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Predicted membrane protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD