Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HutC - Burkholderia

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 46 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Burkholderia pseudomallei K96243 11 4
Burkholderia mallei ATCC 23344 13 4
Burkholderia sp. 383 16 6
Burkholderia cepacia AMMD 17 7
Burkholderia vietnamiensis G4 14 3
Burkholderia glumae BGR1 14 3
Burkholderia xenovorans LB400 13 2
Burkholderia phymatum STM815 13 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
COG834 (HisJ)
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
*
Burkholderia sp. 383

Site:
position = -340
score = 4.40935
sequence = CTCCCTGTATAGACATCACC

Site:
position = -132
score = 4.31925
sequence = TGAGCGGTCTAGACTGCATC

Gene: Bcep18194_B0073: ABC amino acid transporter, periplasmic ligand binding protein
*
Burkholderia cepacia AMMD

Site:
position = -137
score = 4.40007
sequence = CGAGCGGTCTAGACTGCATC

Gene: Bamb_4897: ABC amino acid transporter, periplasmic ligand binding protein
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815
ABC amino acid transporter, periplasmic ligand binding protein
COG5285
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383

Gene: Bcep18194_B0074: Phytanoyl-CoA dioxygenase
 
Burkholderia cepacia AMMD

Gene: Bamb_4896: Phytanoyl-CoA dioxygenase
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400

Gene: Bxe_A1483: Phytanoyl-CoA dioxygenase
 
Burkholderia phymatum STM815
Phytanoyl-CoA dioxygenase
 
CRON 2.
hisJ2
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD

Gene: Bamb_5840: Histidine ABC transporter, histidine-binding periplasmic protein precursor HisJ (TC 3.A.1.3.1)
*
Burkholderia vietnamiensis G4

Site:
position = -235
score = 4.25366
sequence = AAATTTGTCTAGTCATCCTG

Site:
position = -75
score = 5.11355
sequence = ATGCTTGTATAGACAAATTC

Gene: Bcep1808_5569: Histidine ABC transporter, histidine-binding periplasmic protein precursor HisJ (TC 3.A.1.3.1)
*
Burkholderia glumae BGR1

Site:
position = -72
score = 5.49837
sequence = ATTCTTGTCTATACAAGATC

Gene: bglu_1g18060: Histidine ABC transporter, histidine-binding periplasmic protein precursor HisJ (TC 3.A.1.3.1)
*
Burkholderia xenovorans LB400

Site:
position = -240
score = 5.10281
sequence = CAACCTGTCTAGACAAAACA

Site:
position = -67
score = 5.32708
sequence = AGACTTGTCTATACAAATTA

Gene: Bxe_B1829: Histidine ABC transporter, histidine-binding periplasmic protein precursor HisJ (TC 3.A.1.3.1)
*
Burkholderia phymatum STM815

Site:
position = -218
score = 4.26156
sequence = GAACATGTCTAGTCAGCTGC

Site:
position = -66
score = 5.10467
sequence = AGACTTGTCTATACATGTCC

Gene: Bphy_5100: Histidine ABC transporter, histidine-binding periplasmic protein precursor HisJ (TC 3.A.1.3.1)
Histidine ABC transporter, histidine-binding periplasmic protein precursor HisJ (TC 3.A.1.3.1)
hisQ2
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD

Gene: Bamb_5839: Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1)
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_5570: Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1)
 
Burkholderia glumae BGR1

Gene: bglu_1g18050: Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1)
 
Burkholderia xenovorans LB400

Gene: Bxe_B1828: Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1)
 
Burkholderia phymatum STM815

Gene: Bphy_5101: Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1)
Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1)
hisM2
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD

Gene: Bamb_5838: Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1)
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_5571: Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1)
 
Burkholderia glumae BGR1

Gene: bglu_1g18040: Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1)
 
Burkholderia xenovorans LB400

Gene: Bxe_B1827: Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1)
 
Burkholderia phymatum STM815

Gene: Bphy_5102: Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1)
Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1)
hisP2
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD

Gene: Bamb_5837: Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1)
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_5572: Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1)
 
Burkholderia glumae BGR1

Gene: bglu_1g18030: Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1)
 
Burkholderia xenovorans LB400

Gene: Bxe_B1826: Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1)
 
Burkholderia phymatum STM815

Gene: Bphy_5103: Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1)
Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1)
hutH2
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD

Gene: Bamb_5836: Histidine ammonia-lyase (EC 4.3.1.3)
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_5573: Histidine ammonia-lyase (EC 4.3.1.3)
 
Burkholderia glumae BGR1

Gene: bglu_1g18020: Histidine ammonia-lyase (EC 4.3.1.3)
 
Burkholderia xenovorans LB400

Gene: Bxe_B1825: Histidine ammonia-lyase (EC 4.3.1.3)
 
Burkholderia phymatum STM815

Gene: Bphy_5104: Histidine ammonia-lyase (EC 4.3.1.3)
Histidine ammonia-lyase (EC 4.3.1.3)
hutC
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD

Gene: Bamb_5835: Histidine utilization repressor, GntR family
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_5574: Histidine utilization repressor, GntR family
 
Burkholderia glumae BGR1

Gene: bglu_1g18010: Histidine utilization repressor, GntR family
 
Burkholderia xenovorans LB400

Gene: Bxe_B1824: Histidine utilization repressor, GntR family
 
Burkholderia phymatum STM815

Gene: Bphy_5105: Histidine utilization repressor, GntR family
Histidine utilization repressor, GntR family
 
CRON 3.
hisT
*
Burkholderia pseudomallei K96243

Site:
position = -79
score = 5.92124
sequence = CAAGTTGTCTATACAACTTC

Gene: BPSL1280: Histidine transport protein (permease)
*
Burkholderia mallei ATCC 23344

Site:
position = -79
score = 5.92124
sequence = CAAGTTGTCTATACAACTTC

Gene: BMA1774: Histidine transport protein (permease)
*
Burkholderia sp. 383

Site:
position = -77
score = 5.86278
sequence = TAAGTTGTCTATACAACTTG

Gene: Bcep18194_A4320: Histidine transport protein (permease)
*
Burkholderia cepacia AMMD

Site:
position = -77
score = 5.94361
sequence = CAAGTTGTATAGACAACTTG

Gene: Bamb_1095: Histidine transport protein (permease)
 
Burkholderia vietnamiensis G4
*
Burkholderia glumae BGR1

Site:
position = -69
score = 5.49182
sequence = GAACCTGTCTAGACAAGCTC

Gene: bglu_2g11350: Histidine transport protein (permease)
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815
Histidine transport protein (permease)
 
CRON 4.
hisJ
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
*
Burkholderia sp. 383

Site:
position = -141
score = 5.28392
sequence = AAAGTTGTATGTACAACTTG

Gene: Bcep18194_B2378: Histidine ABC transporter, histidine-binding periplasmic protein precursor HisJ (TC 3.A.1.3.1)
*
Burkholderia cepacia AMMD

Site:
position = -113
score = 5.28392
sequence = AAAGTTGTATGTACAACTTG

Gene: Bamb_5463: Histidine ABC transporter, histidine-binding periplasmic protein precursor HisJ (TC 3.A.1.3.1)
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_6664: Histidine ABC transporter, histidine-binding periplasmic protein precursor HisJ (TC 3.A.1.3.1)
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815
Histidine ABC transporter, histidine-binding periplasmic protein precursor HisJ (TC 3.A.1.3.1)
hisQ
*
Burkholderia pseudomallei K96243

Site:
position = -140
score = 5.14852
sequence = AAAGTTGTACATACAACTTC

Gene: BPSS0981: Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1)
*
Burkholderia mallei ATCC 23344

Site:
position = -140
score = 5.14852
sequence = AAAGTTGTACATACAACTTC

Gene: BMAA1240: Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1)
 
Burkholderia sp. 383

Gene: Bcep18194_B2377: Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1)
 
Burkholderia cepacia AMMD

Gene: Bamb_5464: Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1)
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_6665: Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1)
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815
Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1)
hisM
 
Burkholderia pseudomallei K96243

Gene: BPSS0982: Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1)
 
Burkholderia mallei ATCC 23344

Gene: BMAA1239: Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1)
 
Burkholderia sp. 383

Gene: Bcep18194_B2376: Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1)
 
Burkholderia cepacia AMMD

Gene: Bamb_5465: Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1)
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_6666: Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1)
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815
Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1)
hisP
 
Burkholderia pseudomallei K96243

Gene: BPSS0983: Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1)
 
Burkholderia mallei ATCC 23344

Gene: BMAA1238: Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1)
 
Burkholderia sp. 383

Gene: Bcep18194_B2375: Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1)
 
Burkholderia cepacia AMMD

Gene: Bamb_5466: Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1)
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_6667: Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1)
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815
Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1)
 
CRON 5.
COG1457 (CodB)
*
Burkholderia pseudomallei K96243

Site:
position = -71
score = 5.09292
sequence = ACAGTTGTCTATACAATTTT

Gene: BPSS1752: Permease, cytosine/purines, uracil, thiamine, allantoin family protein
*
Burkholderia mallei ATCC 23344

Site:
position = -71
score = 5.09292
sequence = ACAGTTGTCTATACAATTTT

Gene: BMAA0417: Permease, cytosine/purines, uracil, thiamine, allantoin family protein
*2
Burkholderia sp. 383

Gene: Bcep18194_A4386: Permease, cytosine/purines, uracil, thiamine, allantoin family protein

Site:
position = -196
score = 5.88288
sequence = CAAGTTGTATATACAAGATC

Gene: Bcep18194_A4383: Permease, cytosine/purines, uracil, thiamine, allantoin family protein
*
Burkholderia cepacia AMMD

Site:
position = -150
score = 5.65859
sequence = CAAGTTGTATATACAAGAAT

Gene: Bamb_1129: Permease, cytosine/purines, uracil, thiamine, allantoin family protein
*
Burkholderia vietnamiensis G4

Site:
position = -169
score = 5.45042
sequence = CTAGTTGTATATACAACAAT

Gene: Bcep1808_1206: Permease, cytosine/purines, uracil, thiamine, allantoin family protein
 
Burkholderia glumae BGR1

Gene: bglu_1g13020: Permease, cytosine/purines, uracil, thiamine, allantoin family protein
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815
Permease, cytosine/purines, uracil, thiamine, allantoin family protein
 
CRON 6.
hutH
*
Burkholderia pseudomallei K96243

Site:
position = -70
score = 5.83665
sequence = CAAGTTGTCTATACAACATC

Site:
position = -25
score = 5.50468
sequence = AAACTTGTATAGACAGGACC

Gene: BPSL2344: Histidine ammonia-lyase (EC 4.3.1.3)
*
Burkholderia mallei ATCC 23344

Site:
position = -4
score = 5.83665
sequence = CAAGTTGTCTATACAACATC

Gene: BMA0645: Histidine ammonia-lyase (EC 4.3.1.3)
*
Burkholderia sp. 383

Site:
position = -26
score = 5.62002
sequence = GAACTTGTCTAGACAGGATT

Site:
position = -71
score = 5.49985
sequence = CGGGTTGTCTAGACAAGTTG

Gene: Bcep18194_A5482: Histidine ammonia-lyase (EC 4.3.1.3)
*
Burkholderia cepacia AMMD

Site:
position = -71
score = 5.45512
sequence = GGGGTTGTCTAGACAAGTTC

Site:
position = -26
score = 5.62002
sequence = GAACTTGTCTAGACAGGATT

Gene: Bamb_2211: Histidine ammonia-lyase (EC 4.3.1.3)
*
Burkholderia vietnamiensis G4

Site:
position = -26
score = 5.62002
sequence = GAACTTGTCTAGACAGGATT

Site:
position = -71
score = 5.33475
sequence = CGGGTTGTCTAGACAAGTCG

Gene: Bcep1808_2247: Histidine ammonia-lyase (EC 4.3.1.3)
*
Burkholderia glumae BGR1

Site:
position = -69
score = 5.40565
sequence = CGAATTGTCTATACAAGTTG

Site:
position = -26
score = 5.06973
sequence = TCACTTGTATAGACAGGACG

Gene: bglu_1g25210: Histidine ammonia-lyase (EC 4.3.1.3)
*3
Burkholderia xenovorans LB400

Gene: Bxe_A1482: Histidine ammonia-lyase (EC 4.3.1.3)

Gene: Bxe_B0058: Histidine ammonia-lyase (EC 4.3.1.3)

Site:
position = -64
score = 5.69355
sequence = CAAGTTGTATATACAAGAAG

Site:
position = -206
score = 5.35681
sequence = TAAGGTGTATATACAAGTTA

Site:
position = -26
score = 5.03109
sequence = CGAATTGTATAGACAGGACG

Gene: Bxe_A2947: Histidine ammonia-lyase (EC 4.3.1.3)
*
Burkholderia phymatum STM815

Site:
position = -217
score = 5.32747
sequence = GGACGTGTATATACAAGTTG

Site:
position = -27
score = 5.10486
sequence = GAAATTGTATAGACAGGAAC

Site:
position = -64
score = 5.74015
sequence = CGAGTTGTATATACAAGATG

Gene: Bphy_1814: Histidine ammonia-lyase (EC 4.3.1.3)
Histidine ammonia-lyase (EC 4.3.1.3)
hutC
 
Burkholderia pseudomallei K96243

Gene: BPSL2343: Histidine utilization repressor, GntR family
 
Burkholderia mallei ATCC 23344

Gene: BMA0646: Histidine utilization repressor, GntR family
 2
Burkholderia sp. 383

Gene: Bcep18194_A5481: Histidine utilization repressor, GntR family

Gene: Bcep18194_B2386: Histidine utilization repressor, GntR family
*2
Burkholderia cepacia AMMD

Site:
position = -225
score = 3.72532
sequence = GCATTTGTCTATACTTTTCC

Gene: Bamb_5462: Histidine utilization repressor, GntR family

Gene: Bamb_2210: Histidine utilization repressor, GntR family
 2
Burkholderia vietnamiensis G4

Gene: Bcep1808_4120: Histidine utilization repressor, GntR family

Gene: Bcep1808_2246: Histidine utilization repressor, GntR family
 
Burkholderia glumae BGR1

Gene: bglu_1g25200: Histidine utilization repressor, GntR family
 
Burkholderia xenovorans LB400

Gene: Bxe_A2946: Histidine utilization repressor, GntR family
 
Burkholderia phymatum STM815

Gene: Bphy_1813: Histidine utilization repressor, GntR family
Histidine utilization repressor, GntR family
hutU
 
Burkholderia pseudomallei K96243

Gene: BPSL2342: Urocanate hydratase (EC 4.2.1.49)
 
Burkholderia mallei ATCC 23344

Gene: BMA0647: Urocanate hydratase (EC 4.2.1.49)
 
Burkholderia sp. 383

Gene: Bcep18194_A5480: Urocanate hydratase (EC 4.2.1.49)
 
Burkholderia cepacia AMMD

Gene: Bamb_2209: Urocanate hydratase (EC 4.2.1.49)
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_2245: Urocanate hydratase (EC 4.2.1.49)
 
Burkholderia glumae BGR1

Gene: bglu_1g25190: Urocanate hydratase (EC 4.2.1.49)
 
Burkholderia xenovorans LB400

Gene: Bxe_A2945: Urocanate hydratase (EC 4.2.1.49)
 
Burkholderia phymatum STM815

Gene: Bphy_1812: Urocanate hydratase (EC 4.2.1.49)
Urocanate hydratase (EC 4.2.1.49)
hutD
 
Burkholderia pseudomallei K96243

Gene: BPSL2341: Conserved hypothetical protein related to histidine degradation
 
Burkholderia mallei ATCC 23344

Gene: BMA0648: Conserved hypothetical protein related to histidine degradation
 
Burkholderia sp. 383

Gene: Bcep18194_A5479: Conserved hypothetical protein related to histidine degradation
 
Burkholderia cepacia AMMD

Gene: Bamb_2208: Conserved hypothetical protein related to histidine degradation
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_2244: Conserved hypothetical protein related to histidine degradation
 
Burkholderia glumae BGR1

Gene: bglu_1g25180: Conserved hypothetical protein related to histidine degradation
 
Burkholderia xenovorans LB400

Gene: Bxe_A2944: Conserved hypothetical protein related to histidine degradation
 
Burkholderia phymatum STM815

Gene: Bphy_1811: Conserved hypothetical protein related to histidine degradation
Conserved hypothetical protein related to histidine degradation
hutI
 
Burkholderia pseudomallei K96243

Gene: BPSL2340: Imidazolonepropionase (EC 3.5.2.7)
 
Burkholderia mallei ATCC 23344

Gene: BMA0649: Imidazolonepropionase (EC 3.5.2.7)
 
Burkholderia sp. 383

Gene: Bcep18194_A5478: Imidazolonepropionase (EC 3.5.2.7)
 
Burkholderia cepacia AMMD

Gene: Bamb_2207: Imidazolonepropionase (EC 3.5.2.7)
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_2243: Imidazolonepropionase (EC 3.5.2.7)
 
Burkholderia glumae BGR1

Gene: bglu_1g25170: Imidazolonepropionase (EC 3.5.2.7)
 
Burkholderia xenovorans LB400

Gene: Bxe_A2943: Imidazolonepropionase (EC 3.5.2.7)
 
Burkholderia phymatum STM815

Gene: Bphy_1810: Imidazolonepropionase (EC 3.5.2.7)
Imidazolonepropionase (EC 3.5.2.7)
hutF
 
Burkholderia pseudomallei K96243

Gene: BPSL2339: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
 
Burkholderia mallei ATCC 23344

Gene: BMA0650: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
 
Burkholderia sp. 383

Gene: Bcep18194_A5477: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
 
Burkholderia cepacia AMMD

Gene: Bamb_2206: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_2242: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
 
Burkholderia glumae BGR1

Gene: bglu_1g25160: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
 
Burkholderia xenovorans LB400

Gene: Bxe_A2942: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
 
Burkholderia phymatum STM815

Gene: Bphy_1809: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
Formiminoglutamic iminohydrolase (EC 3.5.3.13)
BMA0651
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344

Gene: BMA0651: hypothetical protein
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815
hypothetical protein
hutG
 
Burkholderia pseudomallei K96243

Gene: BPSL2338: N-formylglutamate deformylase (EC 3.5.1.68)
 
Burkholderia mallei ATCC 23344

Gene: BMA0652: N-formylglutamate deformylase (EC 3.5.1.68)
 
Burkholderia sp. 383

Gene: Bcep18194_A5476: N-formylglutamate deformylase (EC 3.5.1.68)
 
Burkholderia cepacia AMMD

Gene: Bamb_2205: N-formylglutamate deformylase (EC 3.5.1.68)
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_2241: N-formylglutamate deformylase (EC 3.5.1.68)
 
Burkholderia glumae BGR1

Gene: bglu_1g25150: N-formylglutamate deformylase (EC 3.5.1.68)
 
Burkholderia xenovorans LB400

Gene: Bxe_A2941: N-formylglutamate deformylase (EC 3.5.1.68)
 
Burkholderia phymatum STM815

Gene: Bphy_1808: N-formylglutamate deformylase (EC 3.5.1.68)
N-formylglutamate deformylase (EC 3.5.1.68)
 
CRON 7.
COG834 (HisJ)
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
*
Burkholderia sp. 383

Site:
position = -207
score = 5.62002
sequence = AATCCTGTCTAGACAAGTTC

Site:
position = -162
score = 5.49985
sequence = CAACTTGTCTAGACAACCCG

Gene: Bcep18194_A5483: ABC amino acid transporter, periplasmic ligand binding protein
*
Burkholderia cepacia AMMD

Site:
position = -148
score = 5.62002
sequence = AATCCTGTCTAGACAAGTTC

Site:
position = -103
score = 5.45512
sequence = GAACTTGTCTAGACAACCCC

Gene: Bamb_2212: ABC amino acid transporter, periplasmic ligand binding protein
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815

Gene: Bphy_4740: ABC amino acid transporter, periplasmic ligand binding protein
ABC amino acid transporter, periplasmic ligand binding protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD