Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HutC - Xanthomonadales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Xylella fastidiosa 9a5c
Xanthomonas axonopodis pv. citri str. 306 5 2
Xanthomonas campestris pv. campestris str. ATCC 33913 6 2
Stenotrophomonas maltophilia K279a 6 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
hutI
 
Xylella fastidiosa 9a5c
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -39
score = 4.61174
sequence = TCTATTGTATATACATATCA

Gene: XAC1638: Imidazolonepropionase (EC 3.5.2.7)
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -39
score = 4.61174
sequence = TCTATTGTATATACATATCA

Gene: XCC1581: Imidazolonepropionase (EC 3.5.2.7)
*
Stenotrophomonas maltophilia K279a

Site:
position = -33
score = 4.96687
sequence = TATATTGTATAGACATATAA

Gene: Smlt3107: Imidazolonepropionase (EC 3.5.2.7)
Imidazolonepropionase (EC 3.5.2.7)
hutH
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC1637: Histidine ammonia-lyase (EC 4.3.1.3)
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC1579: Histidine ammonia-lyase (EC 4.3.1.3)
 
Stenotrophomonas maltophilia K279a

Gene: Smlt3108: Histidine ammonia-lyase (EC 4.3.1.3)
Histidine ammonia-lyase (EC 4.3.1.3)
hutG
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC1636: N-formylglutamate deformylase (EC 3.5.1.68)
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC1578: N-formylglutamate deformylase (EC 3.5.1.68)
 
Stenotrophomonas maltophilia K279a

Gene: Smlt3109: N-formylglutamate deformylase (EC 3.5.1.68)
N-formylglutamate deformylase (EC 3.5.1.68)
hutU
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC1635: Urocanate hydratase (EC 4.2.1.49)
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC1577: Urocanate hydratase (EC 4.2.1.49)
 
Stenotrophomonas maltophilia K279a

Gene: Smlt3110: Urocanate hydratase (EC 4.2.1.49)
Urocanate hydratase (EC 4.2.1.49)
 
CRON 2.
hutF
 
Xylella fastidiosa 9a5c
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -56
score = 4.38323
sequence = TGATATGTATATACAATAGA

Gene: XAC1639: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -56
score = 4.38323
sequence = TGATATGTATATACAATAGA

Gene: XCC1580: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
*
Stenotrophomonas maltophilia K279a

Site:
position = -45
score = 4.32863
sequence = TTATATGTCTATACAATATA

Gene: Smlt3106: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
Formiminoglutamic iminohydrolase (EC 3.5.3.13)
hutC
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC1640: Histidine utilization repressor
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC1582: Histidine utilization repressor
 
Stenotrophomonas maltophilia K279a

Gene: Smlt3105: Histidine utilization repressor
Histidine utilization repressor
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD