Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HutC - Moraxellaceae

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acinetobacter sp. ADP1
Acinetobacter baumannii AB0057 8 3
Psychrobacter arcticum 273-4
Psychrobacter sp. PRwf-1 6 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
hutU
 
Acinetobacter sp. ADP1

Gene: ACIAD1166: Urocanate hydratase (EC 4.2.1.49)
*
Acinetobacter baumannii AB0057

Site:
position = -90
score = 5.62135
sequence = ATGGATGTATATACAAGTTA

Gene: AB57_3860: Urocanate hydratase (EC 4.2.1.49)
 
Psychrobacter arcticum 273-4
*
Psychrobacter sp. PRwf-1

Site:
position = -54
score = 4.99599
sequence = TAATTTGTATATACAAAATC

Gene: PsycPRwf_0852: Urocanate hydratase (EC 4.2.1.49)
Urocanate hydratase (EC 4.2.1.49)
hutH
 
Acinetobacter sp. ADP1

Gene: ACIAD1167: Histidine ammonia-lyase (EC 4.3.1.3)
 
Acinetobacter baumannii AB0057

Gene: AB57_3859: Histidine ammonia-lyase (EC 4.3.1.3)
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1

Gene: PsycPRwf_0850: Histidine ammonia-lyase (EC 4.3.1.3)
Histidine ammonia-lyase (EC 4.3.1.3)
hisT
 
Acinetobacter sp. ADP1

Gene: ACIAD1168: Histidine transport protein (permease)
 
Acinetobacter baumannii AB0057

Gene: AB57_3858: Histidine transport protein (permease)
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1
Histidine transport protein (permease)
hutI
 
Acinetobacter sp. ADP1
 
Acinetobacter baumannii AB0057

Gene: AB57_3857: Imidazolonepropionase (EC 3.5.2.7)
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1

Gene: PsycPRwf_0848: Imidazolonepropionase (EC 3.5.2.7)
Imidazolonepropionase (EC 3.5.2.7)
hutG2
 
Acinetobacter sp. ADP1

Gene: ACIAD1169: Formiminoglutamase (EC 3.5.3.8)
 
Acinetobacter baumannii AB0057

Gene: AB57_3856: Formiminoglutamase (EC 3.5.3.8)
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1

Gene: PsycPRwf_0849: Formiminoglutamase (EC 3.5.3.8)
Formiminoglutamase (EC 3.5.3.8)
COG3314
 
Acinetobacter sp. ADP1
 
Acinetobacter baumannii AB0057
 
Psychrobacter arcticum 273-4
*2
Psychrobacter sp. PRwf-1

Gene: PsycPRwf_1490: Predicted histidine uptake transporter

Site:
position = -207
score = 4.00756
sequence = TAATTTGTCTATAGACATAG

Site:
position = -28
score = 4.02574
sequence = TTATTGCTACAGACAAGGAT

Gene: PsycPRwf_0851: Predicted histidine uptake transporter
Predicted histidine uptake transporter
 
CRON 2.
COG1457 (CodB)
 
Acinetobacter sp. ADP1
*
Acinetobacter baumannii AB0057

Site:
position = -83
score = 5.98369
sequence = TAACTTGTATATACATGTTT

Gene: AB57_1739: Permease, cytosine/purines, uracil, thiamine, allantoin family protein
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1
Permease, cytosine/purines, uracil, thiamine, allantoin family protein
 
CRON 3.
hutC
 
Acinetobacter sp. ADP1
 
Acinetobacter baumannii AB0057
 
Psychrobacter arcticum 273-4
*
Psychrobacter sp. PRwf-1

Site:
position = -156
score = 4.99599
sequence = GATTTTGTATATACAAATTA

Gene: PsycPRwf_0853: Histidine utilization repressor, GntR family
Histidine utilization repressor, GntR family
 
CRON 4.
hutC
 
Acinetobacter sp. ADP1
*
Acinetobacter baumannii AB0057

Site:
position = -67
score = 4.48849
sequence = GTGGTTGTATATACATAGCA

Gene: AB57_3862: Histidine utilization repressor, GntR family
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1
Histidine utilization repressor, GntR family
hutD
 
Acinetobacter sp. ADP1
 
Acinetobacter baumannii AB0057

Gene: AB57_3861: Conserved hypothetical protein related to histidine degradation
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1
Conserved hypothetical protein related to histidine degradation
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD