Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HutC - Pseudomonadaceae

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 22 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Pseudomonas aeruginosa PAO1 13 3
Pseudomonas entomophila L48 9 4
Pseudomonas putida KT2440 8 3
Pseudomonas syringae pv. tomato str. DC3000 12 3
Pseudomonas fluorescens Pf-5 13 3
Pseudomonas mendocina ymp 6 2
Pseudomonas stutzeri A1501
Azotobacter vinelandii AvOP
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
hutC
*
Pseudomonas aeruginosa PAO1

Site:
position = -77
score = 5.40882
sequence = TTATTTGTATATACATATAC

Gene: PA5105: Histidine utilization repressor, GntR family
*
Pseudomonas entomophila L48

Site:
position = -88
score = 5.24889
sequence = CAACTTGTATATACATATAC

Gene: PSEEN5099: Histidine utilization repressor, GntR family
*
Pseudomonas putida KT2440

Site:
position = -88
score = 5.45516
sequence = TAACTTGTATATACATATAC

Gene: PP5035: Histidine utilization repressor, GntR family
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -142
score = 5.25468
sequence = TAATTTGTATATACATATAC

Gene: PSPTO5172: Histidine utilization repressor, GntR family
*
Pseudomonas fluorescens Pf-5

Site:
position = -85
score = 5.40882
sequence = TTATTTGTATATACATATAC

Gene: PFL_0399: Histidine utilization repressor, GntR family
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Histidine utilization repressor, GntR family
hutD
 
Pseudomonas aeruginosa PAO1

Gene: PA5104: Conserved hypothetical protein related to histidine degradation
 
Pseudomonas entomophila L48

Gene: PSEEN5098: Conserved hypothetical protein related to histidine degradation
 
Pseudomonas putida KT2440

Gene: PP5034: Conserved hypothetical protein related to histidine degradation
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO5173: Conserved hypothetical protein related to histidine degradation
 
Pseudomonas fluorescens Pf-5

Gene: PFL_0400: Conserved hypothetical protein related to histidine degradation
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Conserved hypothetical protein related to histidine degradation
 
CRON 2.
hutF
*
Pseudomonas aeruginosa PAO1

Site:
position = -43
score = 5.37873
sequence = GTATATGTATATACAAATAA

Gene: PA5106: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
*
Pseudomonas entomophila L48

Site:
position = -41
score = 5.21446
sequence = GTATATGTATATACAAGTTG

Gene: PSEEN5100: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
*
Pseudomonas putida KT2440

Site:
position = -40
score = 5.43985
sequence = GTATATGTATATACAAGTTA

Gene: PP5036: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -41
score = 5.04775
sequence = GTATATGTATATACAAATTA

Gene: PSPTO5171: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
*
Pseudomonas fluorescens Pf-5

Site:
position = -42
score = 5.37873
sequence = GTATATGTATATACAAATAA

Gene: PFL_0398: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP

Gene: Avin_26300: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
Formiminoglutamic iminohydrolase (EC 3.5.3.13)
 
CRON 3.
hutD
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5
*
Pseudomonas mendocina ymp

Site:
position = -212
score = 4.60639
sequence = TGTTTTGTATATACAATATG

Site:
position = -27
score = 4.23414
sequence = GACCATGTATATACATTTGG

Gene: Pmen_4074: Conserved hypothetical protein related to histidine degradation
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Conserved hypothetical protein related to histidine degradation
 
CRON 4.
hutU
*
Pseudomonas aeruginosa PAO1

Site:
position = -121
score = 5.86309
sequence = ATACTTGTATGTACAAGCAT

Gene: PA5100: Urocanate hydratase (EC 4.2.1.49)
*
Pseudomonas entomophila L48

Site:
position = -84
score = 6.4688
sequence = ATGCTTGTACATACAAGTAA

Gene: PSEEN5097: Urocanate hydratase (EC 4.2.1.49)
*
Pseudomonas putida KT2440

Site:
position = -82
score = 6.4688
sequence = ATGCTTGTACATACAAGTAA

Gene: PP5033: Urocanate hydratase (EC 4.2.1.49)
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -10
score = 4.60975
sequence = TTGATTGCATATGCTTGTAT

Site:
position = 0
score = 5.88365
sequence = ATGCTTGTATGTACAAGTAG

Gene: PSPTO5270: Urocanate hydratase (EC 4.2.1.49)
*
Pseudomonas fluorescens Pf-5

Site:
position = -86
score = 6.10904
sequence = ATGCTTGTATGTACAAGTAA

Site:
position = -96
score = 4.60975
sequence = TTGATTGCATATGCTTGTAT

Gene: PFL_0401: Urocanate hydratase (EC 4.2.1.49)
 
Pseudomonas mendocina ymp

Gene: Pmen_4070: Urocanate hydratase (EC 4.2.1.49)
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP

Gene: Avin_26180: Urocanate hydratase (EC 4.2.1.49)
Urocanate hydratase (EC 4.2.1.49)
COG1457 (CodB)
 
Pseudomonas aeruginosa PAO1

Gene: PA5099: Permease, cytosine/purines, uracil, thiamine, allantoin family protein
*
Pseudomonas entomophila L48

Site:
position = -101
score = 5.13845
sequence = AGACTTGTATATACATGCTC

Gene: PSEEN3026: Permease, cytosine/purines, uracil, thiamine, allantoin family protein
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5

Gene: PFL_0402: Permease, cytosine/purines, uracil, thiamine, allantoin family protein
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Permease, cytosine/purines, uracil, thiamine, allantoin family protein
hutX
 
Pseudomonas aeruginosa PAO1

Gene: PA5096: Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
 
Pseudomonas entomophila L48

Gene: PSEEN2601: Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
 
Pseudomonas putida KT2440

Gene: PP3558: Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO5271: Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_0403: Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
hutW
 
Pseudomonas aeruginosa PAO1

Gene: PA5095: Histidine ABC transporter, permease protein (TC 3.A.1)
 
Pseudomonas entomophila L48

Gene: PSEEN2602: Histidine ABC transporter, permease protein (TC 3.A.1)
 
Pseudomonas putida KT2440

Gene: PP3559: Histidine ABC transporter, permease protein (TC 3.A.1)
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO5272: Histidine ABC transporter, permease protein (TC 3.A.1)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_0404: Histidine ABC transporter, permease protein (TC 3.A.1)
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Histidine ABC transporter, permease protein (TC 3.A.1)
hutV
 
Pseudomonas aeruginosa PAO1

Gene: PA5094: Histidine ABC transporter, ATP-binding protein
 
Pseudomonas entomophila L48

Gene: PSEEN2603: Histidine ABC transporter, ATP-binding protein
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO5273: Histidine ABC transporter, ATP-binding protein
 
Pseudomonas fluorescens Pf-5

Gene: PFL_0405: Histidine ABC transporter, ATP-binding protein
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Histidine ABC transporter, ATP-binding protein
hutH2
 
Pseudomonas aeruginosa PAO1

Gene: PA5093: Histidine ammonia-lyase (EC 4.3.1.3)
 
Pseudomonas entomophila L48

Gene: PSEEN2604: Histidine ammonia-lyase (EC 4.3.1.3)
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO5274: Histidine ammonia-lyase (EC 4.3.1.3)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_0406: Histidine ammonia-lyase (EC 4.3.1.3)
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Histidine ammonia-lyase (EC 4.3.1.3)
hutH
 
Pseudomonas aeruginosa PAO1

Gene: PA5098: Histidine ammonia-lyase (EC 4.3.1.3)
 
Pseudomonas entomophila L48

Gene: PSEEN5096: Histidine ammonia-lyase (EC 4.3.1.3)
 
Pseudomonas putida KT2440

Gene: PP5032: Histidine ammonia-lyase (EC 4.3.1.3)
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO5275: Histidine ammonia-lyase (EC 4.3.1.3)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_0407: Histidine ammonia-lyase (EC 4.3.1.3)
 
Pseudomonas mendocina ymp

Gene: Pmen_4069: Histidine ammonia-lyase (EC 4.3.1.3)
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP

Gene: Avin_26290: Histidine ammonia-lyase (EC 4.3.1.3)
Histidine ammonia-lyase (EC 4.3.1.3)
hisT
 
Pseudomonas aeruginosa PAO1

Gene: PA5097: Histidine transport protein (permease)
 
Pseudomonas entomophila L48

Gene: PSEEN5095: Histidine transport protein (permease)
 
Pseudomonas putida KT2440

Gene: PP5031: Histidine transport protein (permease)
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO5276: Histidine transport protein (permease)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_0408: Histidine transport protein (permease)
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Histidine transport protein (permease)
hutI
 
Pseudomonas aeruginosa PAO1

Gene: PA5092: Imidazolonepropionase (EC 3.5.2.7)
 
Pseudomonas entomophila L48

Gene: PSEEN5094: Imidazolonepropionase (EC 3.5.2.7)
 
Pseudomonas putida KT2440

Gene: PP5030: Imidazolonepropionase (EC 3.5.2.7)
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO5277: Imidazolonepropionase (EC 3.5.2.7)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_0409: Imidazolonepropionase (EC 3.5.2.7)
*
Pseudomonas mendocina ymp

Site:
position = -220
score = 3.80286
sequence = CCAAATGTATATACATGGTC

Site:
position = -35
score = 4.43945
sequence = CATATTGTATATACAAAACA

Gene: Pmen_4073: Imidazolonepropionase (EC 3.5.2.7)
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP

Gene: Avin_26160: Imidazolonepropionase (EC 3.5.2.7)
Imidazolonepropionase (EC 3.5.2.7)
hutG
 
Pseudomonas aeruginosa PAO1

Gene: PA5091: N-formylglutamate deformylase (EC 3.5.1.68)
 
Pseudomonas entomophila L48

Gene: PSEEN5093: N-formylglutamate deformylase (EC 3.5.1.68)
 
Pseudomonas putida KT2440

Gene: PP5029: N-formylglutamate deformylase (EC 3.5.1.68)
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO5278: N-formylglutamate deformylase (EC 3.5.1.68)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_0410: N-formylglutamate deformylase (EC 3.5.1.68)
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP

Gene: Avin_26150: N-formylglutamate deformylase (EC 3.5.1.68)
N-formylglutamate deformylase (EC 3.5.1.68)
hutG2
 
Pseudomonas aeruginosa PAO1

Gene: PA3175: Formiminoglutamase (EC 3.5.3.8)
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5

Gene: PFL_0349: Formiminoglutamase (EC 3.5.3.8)
 
Pseudomonas mendocina ymp

Gene: Pmen_4072: Formiminoglutamase (EC 3.5.3.8)
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Formiminoglutamase (EC 3.5.3.8)
COG3314
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp

Gene: Pmen_4071: Predicted histidine uptake transporter
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Predicted histidine uptake transporter
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD