Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HutC - Oceanospirillales/Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Hahella chejuensis KCTC 2396 4 1
Marinobacter aqueolei
Marinobacter sp. ELB17
Oceanobacter sp. RED65
Oceanospirillum sp. MED92
Marinomonas sp. MWYL1 8 4
Saccharophagus degradans 2-40
Teredinibacter turnerae T7901
Cellvibrio japonicus Ueda107
Chromohalobacter salexigens DSM 3043
Reinekea sp. MED297 5 2
Alcanivorax borkumensis SK2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
COG3314
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
*
Marinomonas sp. MWYL1

Site:
position = -4
score = 5.1259
sequence = TAATATGTATATACATGTTG

Site:
position = -212
score = 4.04561
sequence = TGCTATGTATAGACAACCTT

Gene: Mmwyl1_2465: Predicted histidine uptake transporter
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Predicted histidine uptake transporter
 
CRON 2.
hutF
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
*
Marinomonas sp. MWYL1

Site:
position = -65
score = 5.33992
sequence = ATACTTGTATATACATTATA

Site:
position = -249
score = 5.09554
sequence = GAACATGTATATACAATTAC

Gene: Mmwyl1_3903: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Formiminoglutamic iminohydrolase (EC 3.5.3.13)
hutD
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_3904: protein related to histidine degradation
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
protein related to histidine degradation
 
CRON 3.
hutU
 
Hahella chejuensis KCTC 2396

Gene: HCH_04171: Urocanate hydratase (EC 4.2.1.49)
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
*
Marinomonas sp. MWYL1

Site:
position = -257
score = 5.58184
sequence = TATAATGTATATACAAGTAT

Site:
position = -73
score = 5.0836
sequence = GTAATTGTATATACATGTTC

Gene: Mmwyl1_3902: Urocanate hydratase (EC 4.2.1.49)
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297

Gene: MED297_04894: Urocanate hydratase (EC 4.2.1.49)
 
Alcanivorax borkumensis SK2
Urocanate hydratase (EC 4.2.1.49)
hutH
 
Hahella chejuensis KCTC 2396

Gene: HCH_04172: Histidine ammonia-lyase (EC 4.3.1.3)
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_3901: Histidine ammonia-lyase (EC 4.3.1.3)
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297

Gene: MED297_04889: Histidine ammonia-lyase (EC 4.3.1.3)
 
Alcanivorax borkumensis SK2
Histidine ammonia-lyase (EC 4.3.1.3)
hutI
*
Hahella chejuensis KCTC 2396

Site:
position = -47
score = 5.48426
sequence = TTAAATGTATATACATTTAT

Site:
position = -291
score = 5.61401
sequence = AAATTTGTATATACATTCAA

Gene: HCH_04169: Imidazolonepropionase (EC 3.5.2.7)
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_3900: Imidazolonepropionase (EC 3.5.2.7)
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
*
Reinekea sp. MED297

Site:
position = -35
score = 5.39876
sequence = CAAGTTGTATATACAACTAA

Gene: MED297_04904: Imidazolonepropionase (EC 3.5.2.7)
 
Alcanivorax borkumensis SK2
Imidazolonepropionase (EC 3.5.2.7)
hutG
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_3899: N-formylglutamate deformylase (EC 3.5.1.68)
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
N-formylglutamate deformylase (EC 3.5.1.68)
hutG2
 
Hahella chejuensis KCTC 2396

Gene: HCH_04170: Formiminoglutamase (EC 3.5.3.8)
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297

Gene: MED297_04909: Formiminoglutamase (EC 3.5.3.8)
 
Alcanivorax borkumensis SK2
Formiminoglutamase (EC 3.5.3.8)
hutC
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
*
Marinomonas sp. MWYL1

Site:
position = -73
score = 4.52478
sequence = CTAGATGTATAGACAAGTTG

Gene: Mmwyl1_3905: Histidine utilization repressor, GntR family
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
*
Reinekea sp. MED297

Site:
position = -52
score = 5.2028
sequence = TTAGTTGTATATACAACTTG

Gene: MED297_04899: Histidine utilization repressor, GntR family
 
Alcanivorax borkumensis SK2
Histidine utilization repressor, GntR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD