Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HutC - Psychromonadaceae/Aeromonadales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Psychromonas ingrahamii 37 6 3
Psychromonas sp. CNPT3
Moritella sp. PE36 5 2
Aeromonas hydrophila subsp. hydrophila ATCC 7966 4 1
Aeromonas salmonicida subsp. salmonicida A449 5 2
Tolumonas auensis DSM 9187
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
hutC
*
Psychromonas ingrahamii 37

Site:
position = -44
score = 5.20457
sequence = TTATTTGTATAGTCAATTAA

Gene: Ping_1033: Histidine utilization repressor, GntR family
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -80
score = 4.67654
sequence = TCATTTGTATAGTCAATTAA

Gene: PE36_09016: Histidine utilization repressor, GntR family
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_0376: Histidine utilization repressor, GntR family
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_3956: Histidine utilization repressor, GntR family
 
Tolumonas auensis DSM 9187
Histidine utilization repressor, GntR family
 
CRON 2.
COG3314
*
Psychromonas ingrahamii 37

Site:
position = -95
score = 4.56151
sequence = TTAAATGTATACACATTTTA

Site:
position = -232
score = 5.26566
sequence = TATTGTGTATATACAATTAT

Gene: Ping_1950: Predicted histidine uptake transporter
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -61
score = 4.92606
sequence = AGCATTGTATATACAATTCG

Gene: ASA_2086: Predicted histidine uptake transporter
 
Tolumonas auensis DSM 9187
Predicted histidine uptake transporter
 
CRON 3.
hutI
*
Psychromonas ingrahamii 37

Site:
position = -35
score = 5.70991
sequence = CTAATTGTATATACATTTAA

Gene: Ping_1032: Imidazolonepropionase (EC 3.5.2.7)
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -35
score = 5.91618
sequence = TTAATTGTATATACATTTAA

Gene: PE36_09011: Imidazolonepropionase (EC 3.5.2.7)
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -90
score = 4.93773
sequence = TTAATTGTATATACAAACTC

Gene: AHA_0377: Imidazolonepropionase (EC 3.5.2.7)
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -28
score = 4.59091
sequence = GATAATGTATATACATTTAG

Site:
position = -159
score = 5.22194
sequence = TTAATTGTATATACATATTG

Gene: ASA_3955: Imidazolonepropionase (EC 3.5.2.7)
 
Tolumonas auensis DSM 9187
Imidazolonepropionase (EC 3.5.2.7)
hutG2
 
Psychromonas ingrahamii 37

Gene: Ping_1031: Formiminoglutamase (EC 3.5.3.8)
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_09006: Formiminoglutamase (EC 3.5.3.8)
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_0378: Formiminoglutamase (EC 3.5.3.8)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_3954: Formiminoglutamase (EC 3.5.3.8)
 
Tolumonas auensis DSM 9187
Formiminoglutamase (EC 3.5.3.8)
hutU
 
Psychromonas ingrahamii 37

Gene: Ping_1030: Urocanate hydratase (EC 4.2.1.49)
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_09001: Urocanate hydratase (EC 4.2.1.49)
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_0379: Urocanate hydratase (EC 4.2.1.49)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_3953: Urocanate hydratase (EC 4.2.1.49)
 
Tolumonas auensis DSM 9187
Urocanate hydratase (EC 4.2.1.49)
hutH
 
Psychromonas ingrahamii 37

Gene: Ping_1029: Histidine ammonia-lyase (EC 4.3.1.3)
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_08996: Histidine ammonia-lyase (EC 4.3.1.3)
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_0380: Histidine ammonia-lyase (EC 4.3.1.3)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_3952: Histidine ammonia-lyase (EC 4.3.1.3)
 
Tolumonas auensis DSM 9187
Histidine ammonia-lyase (EC 4.3.1.3)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD