Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HutC - Vibrionales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 20 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Vibrio cholerae O1 biovar eltor str. N16961 5 2
Vibrio vulnificus CMCP6 5 2
Vibrio harveyi ATCC BAA-1116 5 2
Vibrio parahaemolyticus RIMD 2210633 5 2
Vibrio shilonii AK1 5 2
Vibrio splendidus LGP32 6 2
Vibrio fischeri ES114 5 2
Vibrio salmonicida LFI1238 5 2
Vibrio angustum S14 5 2
Photobacterium profundum SS9 5 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
hutI
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -45
score = 5.4411
sequence = TTATTTGTATATACATTTGA

Gene: VC1205: Imidazolonepropionase (EC 3.5.2.7)
*
Vibrio vulnificus CMCP6

Site:
position = -47
score = 5.7887
sequence = TTATTTGTATATACATTTAG

Gene: VV1_2392: Imidazolonepropionase (EC 3.5.2.7)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -47
score = 6.01409
sequence = TTATTTGTATATACATTTAA

Gene: VIBHAR_02075: Imidazolonepropionase (EC 3.5.2.7)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -48
score = 6.01409
sequence = TTATTTGTATATACATTTAA

Gene: VP1276: Imidazolonepropionase (EC 3.5.2.7)
*
Vibrio shilonii AK1

Site:
position = -34
score = 5.69329
sequence = ATATTTGTATATACAATAAA

Gene: VSAK1_17057: Imidazolonepropionase (EC 3.5.2.7)
*
Vibrio splendidus LGP32

Site:
position = -38
score = 6.01409
sequence = TTATTTGTATATACATTTAA

Gene: VS_1219: Imidazolonepropionase (EC 3.5.2.7)
*
Vibrio fischeri ES114

Site:
position = -59
score = 5.65083
sequence = TTATTTGTATATACATATAG

Gene: VF_A0453: Imidazolonepropionase (EC 3.5.2.7)
*
Vibrio salmonicida LFI1238

Site:
position = -52
score = 5.54524
sequence = TTATTTGTATATACATATTA

Gene: VSAL_II0705: Imidazolonepropionase (EC 3.5.2.7)
*
Vibrio angustum S14

Site:
position = -40
score = 5.07325
sequence = ACATTTGTATAGACATTTAA

Gene: VAS14_08550: Imidazolonepropionase (EC 3.5.2.7)
*
Photobacterium profundum SS9

Site:
position = -68
score = 5.31985
sequence = TTATTTGTATATACATATTG

Gene: PBPRA2170: Imidazolonepropionase (EC 3.5.2.7)
Imidazolonepropionase (EC 3.5.2.7)
hutG2
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1204: Formiminoglutamase (EC 3.5.3.8)
 
Vibrio vulnificus CMCP6

Gene: VV1_2391: Formiminoglutamase (EC 3.5.3.8)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_02074: Formiminoglutamase (EC 3.5.3.8)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP1275: Formiminoglutamase (EC 3.5.3.8)
 
Vibrio shilonii AK1

Gene: VSAK1_17062: Formiminoglutamase (EC 3.5.3.8)
 
Vibrio splendidus LGP32

Gene: VS_1218: Formiminoglutamase (EC 3.5.3.8)
 
Vibrio fischeri ES114

Gene: VF_A0452: Formiminoglutamase (EC 3.5.3.8)
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0706: Formiminoglutamase (EC 3.5.3.8)
 
Vibrio angustum S14

Gene: VAS14_08545: Formiminoglutamase (EC 3.5.3.8)
 
Photobacterium profundum SS9

Gene: PBPRA2171: Formiminoglutamase (EC 3.5.3.8)
Formiminoglutamase (EC 3.5.3.8)
hutU
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1203: Urocanate hydratase (EC 4.2.1.49)
 
Vibrio vulnificus CMCP6

Gene: VV1_2390: Urocanate hydratase (EC 4.2.1.49)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_02073: Urocanate hydratase (EC 4.2.1.49)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP1274: Urocanate hydratase (EC 4.2.1.49)
 
Vibrio shilonii AK1

Gene: VSAK1_17067: Urocanate hydratase (EC 4.2.1.49)
 
Vibrio splendidus LGP32

Gene: VS_1217: Urocanate hydratase (EC 4.2.1.49)
 
Vibrio fischeri ES114

Gene: VF_A0451: Urocanate hydratase (EC 4.2.1.49)
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0707: Urocanate hydratase (EC 4.2.1.49)
 
Vibrio angustum S14

Gene: VAS14_08540: Urocanate hydratase (EC 4.2.1.49)
 
Photobacterium profundum SS9

Gene: PBPRA2172: Urocanate hydratase (EC 4.2.1.49)
Urocanate hydratase (EC 4.2.1.49)
hutH
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1202: Histidine ammonia-lyase (EC 4.3.1.3)
 
Vibrio vulnificus CMCP6

Gene: VV1_2389: Histidine ammonia-lyase (EC 4.3.1.3)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_02072: Histidine ammonia-lyase (EC 4.3.1.3)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP1273: Histidine ammonia-lyase (EC 4.3.1.3)
 
Vibrio shilonii AK1

Gene: VSAK1_17072: Histidine ammonia-lyase (EC 4.3.1.3)
 
Vibrio splendidus LGP32

Gene: VS_1216: Histidine ammonia-lyase (EC 4.3.1.3)
 
Vibrio fischeri ES114

Gene: VF_A0450: Histidine ammonia-lyase (EC 4.3.1.3)
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0708: Histidine ammonia-lyase (EC 4.3.1.3)
 
Vibrio angustum S14

Gene: VAS14_08535: Histidine ammonia-lyase (EC 4.3.1.3)
 
Photobacterium profundum SS9

Gene: PBPRA2173: Histidine ammonia-lyase (EC 4.3.1.3)
Histidine ammonia-lyase (EC 4.3.1.3)
hutH2
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_1215: Histidine ammonia-lyase ( EC:4.3.1.3 )
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Histidine ammonia-lyase ( EC:4.3.1.3 )
 
CRON 2.
hutC
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -40
score = 4.05697
sequence = TGATTTGTCTATGCAAATGA

Gene: VC1206: Histidine utilization repressor, GntR family
*
Vibrio vulnificus CMCP6

Site:
position = -30
score = 4.77291
sequence = CTATTTGTATAGTCAATTAG

Gene: VV1_2393: Histidine utilization repressor, GntR family
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -32
score = 4.9983
sequence = CTATTTGTATAGTCAATTAA

Gene: VIBHAR_02076: Histidine utilization repressor, GntR family
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -32
score = 4.58516
sequence = GTATTTGTATAGTCAATTTA

Gene: VP1277: Histidine utilization repressor, GntR family
*
Vibrio shilonii AK1

Site:
position = -38
score = 4.57121
sequence = CCATTTGTATATTCAATTTA

Gene: VSAK1_17047: Histidine utilization repressor, GntR family
*
Vibrio splendidus LGP32

Site:
position = -29
score = 4.86043
sequence = CTATTTGTATAGTCAAATAA

Gene: VS_1220: Histidine utilization repressor, GntR family
*
Vibrio fischeri ES114

Site:
position = -33
score = 4.87359
sequence = TTATTTGTATAGTCAATTTA

Gene: VF_A0454: Histidine utilization repressor, GntR family
*
Vibrio salmonicida LFI1238

Site:
position = -33
score = 4.87359
sequence = TTATTTGTATAGTCAATTTA

Gene: VSAL_II0704: Histidine utilization repressor, GntR family
*
Vibrio angustum S14

Site:
position = -34
score = 4.4884
sequence = TAATTTGTATATACACAATA

Gene: VAS14_08555: Histidine utilization repressor, GntR family
*
Photobacterium profundum SS9

Site:
position = -32
score = 5.20457
sequence = TTATTTGTATAGGCAATTAT

Gene: PBPRA2169: Histidine utilization repressor, GntR family
Histidine utilization repressor, GntR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD