Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HutC - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 27 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Escherichia coli str. K-12 substr. MG1655
Salmonella typhimurium LT2 3 1
Citrobacter koseri ATCC BAA-895 12 3
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 8 4
Enterobacter sp. 638 5 2
Erwinia amylovora ATCC 49946 7 4
Yersinia pestis KIM 7 4
Serratia proteamaculans 568 12 4
Erwinia carotovora subsp. atroseptica SCRI1043
Edwardsiella tarda EIB202
Proteus mirabilis HI4320
Photorhabdus luminescens subsp. laumondii TTO1 6 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
COG1457 (CodB)
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -111
score = 5.87176
sequence = ATGCTTGTATATACAAGAAC

Gene: KPN_01286: Permease, cytosine/purines, uracil, thiamine, allantoin family protein
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946

Gene: EAM_2047: Permease, cytosine/purines, uracil, thiamine, allantoin family protein
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Permease, cytosine/purines, uracil, thiamine, allantoin family protein
 
CRON 2.
hutU
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
*
Citrobacter koseri ATCC BAA-895

Site:
position = -61
score = 5.33952
sequence = CAAGTTGTATAGACAAGTAT

Gene: CKO_02357: Urocanate hydratase (EC 4.2.1.49)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -62
score = 6.11964
sequence = ATGCTTGTATAGACAAGTAT

Gene: KPN_00795: Urocanate hydratase (EC 4.2.1.49)
*
Enterobacter sp. 638

Site:
position = -58
score = 4.93645
sequence = GGGGTTGTCTATACAAGTAT

Gene: Ent638_1263: Urocanate hydratase (EC 4.2.1.49)
 
Erwinia amylovora ATCC 49946

Gene: EAM_1253: Urocanate hydratase (EC 4.2.1.49)
*
Yersinia pestis KIM

Site:
position = -72
score = 5.86861
sequence = GTACTTGTCTATACAAGTAT

Gene: y4038: Urocanate hydratase (EC 4.2.1.49)
*
Serratia proteamaculans 568

Site:
position = -20
score = 6.28949
sequence = ATGCTTGTACATACAAGTAT

Gene: Spro_0805: Urocanate hydratase (EC 4.2.1.49)
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -69
score = 4.58751
sequence = TCTATTGAATATACATGTAT

Site:
position = -59
score = 5.98791
sequence = ATACATGTATATACAACTAT

Gene: plu3193: Urocanate hydratase (EC 4.2.1.49)
Urocanate hydratase (EC 4.2.1.49)
hutH
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2

Gene: STM0791: Histidine ammonia-lyase (EC 4.3.1.3)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02356: Histidine ammonia-lyase (EC 4.3.1.3)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00796: Histidine ammonia-lyase (EC 4.3.1.3)
 
Enterobacter sp. 638

Gene: Ent638_1264: Histidine ammonia-lyase (EC 4.3.1.3)
*
Erwinia amylovora ATCC 49946

Site:
position = -83
score = 4.18381
sequence = AGACAAGAATATACAAATGT

Site:
position = -93
score = 5.04691
sequence = GTAGTTGTATAGACAAGAAT

Gene: EAM_1254: Histidine ammonia-lyase (EC 4.3.1.3)
 
Yersinia pestis KIM

Gene: y4037: Histidine ammonia-lyase (EC 4.3.1.3)
 
Serratia proteamaculans 568

Gene: Spro_0804: Histidine ammonia-lyase (EC 4.3.1.3)
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3192: Histidine ammonia-lyase (EC 4.3.1.3)
Histidine ammonia-lyase (EC 4.3.1.3)
hisT
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00797: Histidine transport protein (permease)
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y4036: Histidine transport protein (permease)
 
Serratia proteamaculans 568

Gene: Spro_0803: Histidine transport protein (permease)
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3191: Histidine transport protein (permease)
Histidine transport protein (permease)
hutX
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_0802: Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
hutW
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_0801: Histidine ABC transporter, permease protein (TC 3.A.1)
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Histidine ABC transporter, permease protein (TC 3.A.1)
hutV
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_0800: Histidine ABC transporter, ATP-binding protein (TC 3.A.1)
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Histidine ABC transporter, ATP-binding protein (TC 3.A.1)
hutH2
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_0799: Histidine ammonia-lyase (EC 4.3.1.3)
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Histidine ammonia-lyase (EC 4.3.1.3)
 
CRON 3.
hutI
 
Escherichia coli str. K-12 substr. MG1655
*
Salmonella typhimurium LT2

Site:
position = -43
score = 4.73636
sequence = ATAAATGTCTATACAACCCA

Gene: STM0787: Imidazolonepropionase (EC 3.5.2.7)
*
Citrobacter koseri ATCC BAA-895

Site:
position = -29
score = 4.73636
sequence = ATAAATGTATAGACAACCCA

Gene: CKO_02360: Imidazolonepropionase (EC 3.5.2.7)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -36
score = 4.73636
sequence = ATAAATGTCTATACAACCCA

Gene: KPN_00792: Imidazolonepropionase (EC 3.5.2.7)
*
Enterobacter sp. 638

Site:
position = -4
score = 4.86622
sequence = ATAAATGTCTATACAACTCA

Gene: Ent638_1260: Imidazolonepropionase (EC 3.5.2.7)
*
Erwinia amylovora ATCC 49946

Site:
position = -63
score = 4.59801
sequence = GAGGTTGTATATACATATAC

Gene: EAM_1258: Imidazolonepropionase (EC 3.5.2.7)
*
Yersinia pestis KIM

Site:
position = -113
score = 5.89372
sequence = ATGATTGTATATACAAGTTG

Gene: y2340: Imidazolonepropionase (EC 3.5.2.7)
*
Serratia proteamaculans 568

Site:
position = -51
score = 5.87955
sequence = TTAATTGTATATACAACCAT

Gene: Spro_2077: Imidazolonepropionase (EC 3.5.2.7)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1022: Imidazolonepropionase (EC 3.5.2.7)
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -104
score = 5.89505
sequence = ATAAATGTATATACAATTAA

Gene: plu3197: Imidazolonepropionase (EC 3.5.2.7)
Imidazolonepropionase (EC 3.5.2.7)
hutG2
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2

Gene: STM0788: Formiminoglutamase (EC 3.5.3.8)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02359: Formiminoglutamase (EC 3.5.3.8)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00793: Formiminoglutamase (EC 3.5.3.8)
 
Enterobacter sp. 638

Gene: Ent638_1261: Formiminoglutamase (EC 3.5.3.8)
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3196: Formiminoglutamase (EC 3.5.3.8)
Formiminoglutamase (EC 3.5.3.8)
hutC
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2

Gene: STM0789: Histidine utilization repressor, GntR family
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02358: Histidine utilization repressor, GntR family
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00794: Histidine utilization repressor, GntR family
 
Enterobacter sp. 638

Gene: Ent638_1262: Histidine utilization repressor, GntR family
*
Erwinia amylovora ATCC 49946

Site:
position = -202
score = 5.04691
sequence = ATTCTTGTCTATACAACTAC

Site:
position = -212
score = 4.18381
sequence = ACATTTGTATATTCTTGTCT

Gene: EAM_1255: Histidine utilization repressor, GntR family
*
Yersinia pestis KIM

Site:
position = -80
score = 5.78482
sequence = TTACTTGTATATACATATAC

Gene: y2339: Histidine utilization repressor, GntR family
*
Serratia proteamaculans 568

Site:
position = -80
score = 5.32729
sequence = TTAGTTGTATATACATATAC

Gene: Spro_2078: Histidine utilization repressor, GntR family
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3195: Histidine utilization repressor, GntR family
Histidine utilization repressor, GntR family
hutG
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946

Gene: EAM_1259: N-formylglutamate deformylase (EC 3.5.1.68)
 
Yersinia pestis KIM

Gene: y2341: N-formylglutamate deformylase (EC 3.5.1.68)
 
Serratia proteamaculans 568

Gene: Spro_2076: N-formylglutamate deformylase (EC 3.5.1.68)
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
N-formylglutamate deformylase (EC 3.5.1.68)
 
CRON 4.
COG1732 (OpuBC)
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
*
Citrobacter koseri ATCC BAA-895

Site:
position = -50
score = 5.98323
sequence = TGGTTTGTATATACAAGTAA

Gene: CKO_02925: ABC proline/glycine/betaine transporter, periplasmic binding domain
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
ABC proline/glycine/betaine transporter, periplasmic binding domain
hutH2
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02926: Histidine ammonia-lyase (EC 4.3.1.3)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Histidine ammonia-lyase (EC 4.3.1.3)
COG1174 (OpuBB)
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 2
Citrobacter koseri ATCC BAA-895

Gene: CKO_02927: ABC proline/glycine/betaine transporter, permease component

Gene: CKO_02928: ABC proline/glycine/betaine transporter, permease component
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
ABC proline/glycine/betaine transporter, permease component
COG1125 (OpuBA)
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02929: ABC proline/glycine/betaine transporter, ATPase component
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
ABC proline/glycine/betaine transporter, ATPase component
COG2423
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02930: Predicted ornithine cyclodeaminase, mu-crystallin homolog (EC 4.3.1.12)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Predicted ornithine cyclodeaminase, mu-crystallin homolog (EC 4.3.1.12)
COG3221 (PhnD)
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02931: ABC phosphate/phosphonate transporter, periplasmic binding component
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638

Gene: Ent638_2351: ABC phosphate/phosphonate transporter, periplasmic binding component
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_1449: ABC phosphate/phosphonate transporter, periplasmic binding component
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
ABC phosphate/phosphonate transporter, periplasmic binding component
 
CRON 5.
hutF
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
*
Erwinia amylovora ATCC 49946

Site:
position = -38
score = 4.59801
sequence = GTATATGTATATACAACCTC

Gene: EAM_1257: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
*
Yersinia pestis KIM

Site:
position = -33
score = 5.78482
sequence = GTATATGTATATACAAGTAA

Gene: y2338: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
*
Serratia proteamaculans 568

Site:
position = -117
score = 5.32729
sequence = GTATATGTATATACAACTAA

Gene: Spro_2079: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Formiminoglutamic iminohydrolase (EC 3.5.3.13)
hutD
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1742: Conserved hypothetical protein related to histidine degradation
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01767: Conserved hypothetical protein related to histidine degradation
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -147
score = 5.87176
sequence = GTTCTTGTATATACAAGCAT

Gene: KPN_01285: Conserved hypothetical protein related to histidine degradation
 
Enterobacter sp. 638

Gene: Ent638_1702: Conserved hypothetical protein related to histidine degradation
 
Erwinia amylovora ATCC 49946

Gene: EAM_1256: Conserved hypothetical protein related to histidine degradation
 
Yersinia pestis KIM

Gene: y2337: Conserved hypothetical protein related to histidine degradation
 
Serratia proteamaculans 568

Gene: Spro_2080: Conserved hypothetical protein related to histidine degradation
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Conserved hypothetical protein related to histidine degradation
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD