Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog LldR - Rhodospirillales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Lactate utilization
Effector: L-lactate
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Rhodospirillum rubrum ATCC 11170 6 2
Magnetospirillum magnetotacticum MS-1 4 4
Magnetospirillum magneticum AMB-1 6 3
Azospirillum sp. B510 6 2
Rhodospirillum centenum SW
Gluconacetobacter diazotrophicus PAl 5
Acetobacter pasteurianus IFO 3283-01
Gluconobacter oxydans 621H
Granulibacter bethesdensis CGDNIH1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
lldR
*
Rhodospirillum rubrum ATCC 11170

Site:
position = -164
score = 5.92347
sequence = TTGGTCAAGAAGTATGACCAC

Gene: Rru_A1414: Lactate-responsive regulator LldR, GntR family
*2
Magnetospirillum magnetotacticum MS-1

Site:
position = -105
score = 5.62538
sequence = GTGGTAACAAAATTTGACCAG

Gene: Magn03010148: Lactate-responsive regulator LldR, GntR family

Site:
position = -118
score = 4.71392
sequence = GTGGATAAAACTTTTTACCAC

Gene: Magn03010985: Lactate-responsive regulator LldR, GntR family
*
Magnetospirillum magneticum AMB-1

Site:
position = -118
score = 4.28949
sequence = CTGGATAAAACTTTTTACCAC

Gene: amb0238: Lactate-responsive regulator LldR, GntR family
*
Azospirillum sp. B510

Site:
position = -194
score = 5.07057
sequence = TTGGATAAATTATTTTACCAG

Gene: AZL_e03820: Lactate-responsive regulator LldR, GntR family
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
Lactate-responsive regulator LldR, GntR family
 
CRON 2.
lldP
 
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A1409: L-lactate permease
*
Magnetospirillum magnetotacticum MS-1

Site:
position = -96
score = 5.31238
sequence = CTGGTCAAATTTTGTTACCAC

Gene: Magn03010149: L-lactate permease
*
Magnetospirillum magneticum AMB-1

Site:
position = -197
score = 6.28012
sequence = GTGGTAAAATTATTTTGCCAA

Gene: amb4128: L-lactate permease
*
Azospirillum sp. B510

Site:
position = -333
score = 5.24461
sequence = CTGGTAAAATAATTTATCCAA

Gene: AZL_e03830: L-lactate permease
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
L-lactate permease
dld
 
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A1410: D-lactate dehydrogenase
 2
Magnetospirillum magnetotacticum MS-1

Gene: Magn03000069: D-lactate dehydrogenase

Gene: Magn03009925: D-lactate dehydrogenase
 
Magnetospirillum magneticum AMB-1

Gene: amb4132: D-lactate dehydrogenase
 
Azospirillum sp. B510

Gene: AZL_e03840: D-lactate dehydrogenase
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
D-lactate dehydrogenase
lldE
*
Rhodospirillum rubrum ATCC 11170

Site:
position = -241
score = 6.04235
sequence = GTGGTCATACTTCTTGACCAA

Gene: Rru_A1413: L-lactate dehydrogenase, Fe-S oxidoreductase subunit LldE
*2
Magnetospirillum magnetotacticum MS-1

Gene: Magn03009929: L-lactate dehydrogenase, Fe-S oxidoreductase subunit LldE

Site:
position = -117
score = 5.80054
sequence = TTGGCAAAATAATTTTACCAC

Gene: Magn03010147: L-lactate dehydrogenase, Fe-S oxidoreductase subunit LldE
*
Magnetospirillum magneticum AMB-1

Site:
position = -50
score = 5.80054
sequence = TTGGCAAAATAATTTTACCAC

Gene: amb4129: L-lactate dehydrogenase, Fe-S oxidoreductase subunit LldE
 
Azospirillum sp. B510

Gene: AZL_e03850: L-lactate dehydrogenase, Fe-S oxidoreductase subunit LldE
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
L-lactate dehydrogenase, Fe-S oxidoreductase subunit LldE
lldF
 
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A1412: L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit LldF
 
Magnetospirillum magnetotacticum MS-1

Gene: Magn03009928: L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit LldF
 
Magnetospirillum magneticum AMB-1

Gene: amb4130: L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit LldF
 
Azospirillum sp. B510

Gene: AZL_e03860: L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit LldF
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit LldF
lldG
 
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A1411: L-lactate dehydrogenase, subunit LldG
 
Magnetospirillum magnetotacticum MS-1

Gene: Magn03009927: L-lactate dehydrogenase, subunit LldG
 
Magnetospirillum magneticum AMB-1

Gene: amb4131: L-lactate dehydrogenase, subunit LldG
 
Azospirillum sp. B510

Gene: AZL_e03870: L-lactate dehydrogenase, subunit LldG
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
L-lactate dehydrogenase, subunit LldG
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD