Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog LldR - Rhodobacterales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Lactate utilization
Effector: L-lactate
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Rhodobacter sphaeroides 2.4.1
Paracoccus denitrificans PD1222 6 2
Jannaschia sp. CCS1
Rhodobacterales bacterium HTCC2654 2 2
Oceanicola granulosus HTCC2516
Loktanella vestfoldensis SKA53
Oceanicola batsensis HTCC2597
Roseovarius nubinhibens ISM
Roseovarius sp. 217
Sulfitobacter sp. EE-36
Silicibacter TM1040
Silicibacter pomeroyi DSS-3
Roseobacter sp. MED193
Hyphomonas neptunium ATCC 15444
Oceanicaulis alexandrii HTCC2633
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
dld
 
Rhodobacter sphaeroides 2.4.1
*
Paracoccus denitrificans PD1222

Site:
position = -102
score = 6.0498
sequence = ATGGTCAAATTATTTTACCAA

Gene: Pden_2928: D-Lactate dehydrogenase
 
Jannaschia sp. CCS1
*
Rhodobacterales bacterium HTCC2654

Site:
position = -112
score = 5.11827
sequence = GTGGTCAATAATATTTACCAC

Gene: RB2654_23243: D-Lactate dehydrogenase
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_1654: D-Lactate dehydrogenase
 
Oceanicaulis alexandrii HTCC2633
D-Lactate dehydrogenase
lldP
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_2927: L-lactate permease
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
L-lactate permease
lldE
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_2926: L-lactate dehydrogenase, Fe-S oxidoreductase subunit LldE
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
L-lactate dehydrogenase, Fe-S oxidoreductase subunit LldE
lldF
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_2925: L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit LldF
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit LldF
lldG
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_2924: L-lactate dehydrogenase, subunit LldG
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
L-lactate dehydrogenase, subunit LldG
 
CRON 2.
lldR
 
Rhodobacter sphaeroides 2.4.1
*
Paracoccus denitrificans PD1222

Site:
position = -133
score = 6.54946
sequence = TTGGTAAAATAATTTGACCAT

Gene: Pden_2929: Lactate-responsive regulator LldR, GntR family
 
Jannaschia sp. CCS1
*
Rhodobacterales bacterium HTCC2654

Site:
position = -170
score = 5.31238
sequence = GTGGTAAATATTATTGACCAC

Gene: RB2654_23238: Lactate-responsive regulator LldR, GntR family
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Lactate-responsive regulator LldR, GntR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD