Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Zur - Desulfuromonadales

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/delta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Geobacter metallireducens GS-15
Geobacter sulfurreducens PCA 4 1
Geobacter uraniumreducens Rf4 4 1
Geobacter sp. FRC-32 4 1
Geobacter sp. M21 4 1
Geobacter lovleyi SZ
Pelobacter propionicus DSM 2379
Pelobacter carbinolicus str. DSM 2380
Desulfuromonas acetoxidans DSM 684
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
zur
 
Geobacter metallireducens GS-15
*
Geobacter sulfurreducens PCA

Site:
position = -41
score = 7.47762
sequence = TAAATGGAAATGATTTCTGTTTA

Gene: GSU2987: Zinc uptake regulation protein Zur
*
Geobacter uraniumreducens Rf4

Site:
position = -217
score = 7.93219
sequence = TAAAAAGAAATGATTTCTATTTA

Gene: Gura_0045: Zinc uptake regulation protein Zur
*
Geobacter sp. FRC-32

Site:
position = -51
score = 7.93219
sequence = TAAAAAGAAATGATTTCTATTTA

Gene: Geob_0042: Zinc uptake regulation protein Zur
*
Geobacter sp. M21

Site:
position = -32
score = 7.47762
sequence = TAAAACGAAATCATTTCCATTTA

Gene: GM21_3601: Zinc uptake regulation protein Zur
 
Geobacter lovleyi SZ
 
Pelobacter propionicus DSM 2379
 
Pelobacter carbinolicus str. DSM 2380
 
Desulfuromonas acetoxidans DSM 684
Zinc uptake regulation protein Zur
znuA
 
Geobacter metallireducens GS-15

Gene: Gmet_0491: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Geobacter sulfurreducens PCA

Gene: GSU2986: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Geobacter uraniumreducens Rf4

Gene: Gura_0046: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Geobacter sp. FRC-32

Gene: Geob_0043: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Geobacter sp. M21

Gene: GM21_3600: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Geobacter lovleyi SZ

Gene: Glov_1833: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Pelobacter propionicus DSM 2379

Gene: Ppro_2139: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Pelobacter carbinolicus str. DSM 2380
 
Desulfuromonas acetoxidans DSM 684
Zinc ABC transporter, periplasmic-binding protein ZnuA
znuC
 
Geobacter metallireducens GS-15

Gene: Gmet_0492: Zinc ABC transporter, ATP-binding protein ZnuC
 
Geobacter sulfurreducens PCA

Gene: GSU2985: Zinc ABC transporter, ATP-binding protein ZnuC
 
Geobacter uraniumreducens Rf4

Gene: Gura_0047: Zinc ABC transporter, ATP-binding protein ZnuC
 
Geobacter sp. FRC-32

Gene: Geob_0044: Zinc ABC transporter, ATP-binding protein ZnuC
 
Geobacter sp. M21

Gene: GM21_3599: Zinc ABC transporter, ATP-binding protein ZnuC
 
Geobacter lovleyi SZ

Gene: Glov_1834: Zinc ABC transporter, ATP-binding protein ZnuC
 
Pelobacter propionicus DSM 2379

Gene: Ppro_2138: Zinc ABC transporter, ATP-binding protein ZnuC
 
Pelobacter carbinolicus str. DSM 2380
 
Desulfuromonas acetoxidans DSM 684
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
 
Geobacter metallireducens GS-15

Gene: Gmet_0493: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Geobacter sulfurreducens PCA

Gene: GSU2984: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Geobacter uraniumreducens Rf4

Gene: Gura_0048: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Geobacter sp. FRC-32

Gene: Geob_0045: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Geobacter sp. M21

Gene: GM21_3598: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Geobacter lovleyi SZ

Gene: Glov_1835: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Pelobacter propionicus DSM 2379

Gene: Ppro_2137: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Pelobacter carbinolicus str. DSM 2380
 
Desulfuromonas acetoxidans DSM 684
Zinc ABC transporter, inner membrane permease protein ZnuB
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD