Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Zur - Caulobacterales

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Caulobacter crescentus CB15 10 6
Caulobacter segnis ATCC 21756 9 5
Caulobacter sp. K31 5 3
Phenylobacterium zucineum HLK1 2 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
znuL
*
Caulobacter crescentus CB15

Site:
position = -66
score = 6.2668
sequence = GATACGTTATTTCATAACAGTCT

Gene: CC0214: Zinc-regulated TonB-dependent outer membrane transporter
*
Caulobacter segnis ATCC 21756

Site:
position = -70
score = 6.28954
sequence = GATATGTTATTTCATAACAGCTA

Gene: Cseg_3938: Zinc-regulated TonB-dependent outer membrane transporter
*
Caulobacter sp. K31

Site:
position = -62
score = 6.59686
sequence = GATATGTTATTTCATAACACTTC

Gene: Caul_4694: Zinc-regulated TonB-dependent outer membrane transporter
*
Phenylobacterium zucineum HLK1

Site:
position = -19
score = 6.24672
sequence = GTTATGTTATTTCATAACAGTGA

Gene: PHZ_c0823: Zinc-regulated TonB-dependent outer membrane transporter
Zinc-regulated TonB-dependent outer membrane transporter
 
CRON 2.
znuK
*
Caulobacter crescentus CB15

Site:
position = -97
score = 5.90658
sequence = GTGATGTTATATCATAACAATTG

Gene: CC1517: Zinc-regulated TonB-dependent outer membrane transporter
*
Caulobacter segnis ATCC 21756

Site:
position = -96
score = 6.06986
sequence = GTAATGTTATATCGTAACAATTA

Gene: Cseg_3085: Zinc-regulated TonB-dependent outer membrane transporter
 
Caulobacter sp. K31
 
Phenylobacterium zucineum HLK1
Zinc-regulated TonB-dependent outer membrane transporter
 
CRON 3.
rplU
*
Caulobacter crescentus CB15

Site:
position = -191
score = 5.77883
sequence = AGCGTGTTATAAAGTAACATTCC

Gene: CC0319: 50S ribosomal protein L21
*
Caulobacter segnis ATCC 21756

Site:
position = -191
score = 5.63562
sequence = AGCGTGTTATAAAGTAACACACC

Gene: Cseg_3837: 50S ribosomal protein L21
*
Caulobacter sp. K31

Site:
position = -174
score = 5.88769
sequence = AGACTGTTATATTGTAACACGCC

Gene: Caul_0194: 50S ribosomal protein L21
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c0258: 50S ribosomal protein L21
50S ribosomal protein L21
rpmA
 
Caulobacter crescentus CB15

Gene: CC0318: 50S ribosomal protein L27
 
Caulobacter segnis ATCC 21756

Gene: Cseg_3838: 50S ribosomal protein L27
 
Caulobacter sp. K31

Gene: Caul_0193: 50S ribosomal protein L27
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c0257: 50S ribosomal protein L27
50S ribosomal protein L27
 
CRON 4.
zrpW
*
Caulobacter crescentus CB15

Site:
position = -35
score = 6.33458
sequence = GGAATGTTACTTTATAACACGCT

Gene: CC0320: Conserved hypothetical protein CC0320
*
Caulobacter segnis ATCC 21756

Site:
position = -36
score = 6.38871
sequence = GGTGTGTTACTTTATAACACGCT

Gene: Cseg_3836: Conserved hypothetical protein CC0320
*
Caulobacter sp. K31

Site:
position = -35
score = 6.16018
sequence = GGCGTGTTACAATATAACAGTCT

Gene: Caul_0195: Conserved hypothetical protein CC0320
 
Phenylobacterium zucineum HLK1
Conserved hypothetical protein CC0320
yciC
 
Caulobacter crescentus CB15

Gene: CC0321: Putative zinc chaperone, COG0523 family
 
Caulobacter segnis ATCC 21756

Gene: Cseg_3835: Putative zinc chaperone, COG0523 family
 
Caulobacter sp. K31

Gene: Caul_0196: Putative zinc chaperone, COG0523 family
*
Phenylobacterium zucineum HLK1

Site:
position = -75
score = 5.83937
sequence = CATGTGTTACTTTATAACATCCC

Gene: PHZ_c3369: Putative zinc chaperone, COG0523 family
Putative zinc chaperone, COG0523 family
 
CRON 5.
znuM
*
Caulobacter crescentus CB15

Site:
position = -35
score = 4.06894
sequence = CCCCTGTTACAGAATAACAGGGG

Gene: CC0663: Zinc-regulated TonB-dependent outer membrane transporter
 
Caulobacter segnis ATCC 21756
 
Caulobacter sp. K31
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c1090: Zinc-regulated TonB-dependent outer membrane transporter
Zinc-regulated TonB-dependent outer membrane transporter
 
CRON 6.
znuG
*
Caulobacter crescentus CB15

Site:
position = -73
score = 4.30095
sequence = CAATTGTTATGATATAACATCAC

Gene: CC1518: Zinc-regulated ABC transporter, ATP-binding protein
*
Caulobacter segnis ATCC 21756

Site:
position = -65
score = 4.17665
sequence = TAATTGTTACGATATAACATTAC

Gene: Cseg_3084: Zinc-regulated ABC transporter, ATP-binding protein
 
Caulobacter sp. K31
 
Phenylobacterium zucineum HLK1
Zinc-regulated ABC transporter, ATP-binding protein
znuH
 
Caulobacter crescentus CB15

Gene: CC1519: Zinc-regulated ABC transporter, permease component
 
Caulobacter segnis ATCC 21756

Gene: Cseg_3083: Zinc-regulated ABC transporter, permease component
 
Caulobacter sp. K31
 
Phenylobacterium zucineum HLK1
Zinc-regulated ABC transporter, permease component
znuI
 
Caulobacter crescentus CB15

Gene: CC1520: Zinc-regulated ABC transporter, permease component
 
Caulobacter segnis ATCC 21756

Gene: Cseg_3082: Zinc-regulated ABC transporter, permease component
 
Caulobacter sp. K31
 
Phenylobacterium zucineum HLK1
Zinc-regulated ABC transporter, permease component
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD