Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Zur - Sphingomonadales

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 21 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Erythrobacter litoralis HTCC2594 2 2
Erythrobacter sp. NAP1 2 2
Novosphingobium aromaticivorans DSM 12444 2 2
Sphingopyxis alaskensis RB2256 3 3
Sphingobium japonicum UT26S 4 4
Sphingomonas wittichii RW1 2 2
Zymomonas mobilis subsp. mobilis ZM4 7 6
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
omr1
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1
 
Novosphingobium aromaticivorans DSM 12444
 
Sphingopyxis alaskensis RB2256
 
Sphingobium japonicum UT26S
 
Sphingomonas wittichii RW1
*
Zymomonas mobilis subsp. mobilis ZM4

Site:
position = -35
score = 5.27228
sequence = GATATGATATATTATATCATCTA

Gene: ZMO0795: Predicted zinc-regulated TonB-dependent outer membrane transporter
Predicted zinc-regulated TonB-dependent outer membrane transporter
 
CRON 2.
omr
*
Erythrobacter litoralis HTCC2594

Site:
position = -89
score = 5.10701
sequence = ATAATGTTATTCTGTATCATCCG

Gene: ELI_11505: Predicted zinc-regulated TonB-dependent outer membrane transporter
*
Erythrobacter sp. NAP1

Site:
position = -56
score = 5.63837
sequence = ACGTTGTTACATTGTAACGTTAT

Gene: NAP1_14638: Predicted zinc-regulated TonB-dependent outer membrane transporter
*
Novosphingobium aromaticivorans DSM 12444

Site:
position = -109
score = 5.6322
sequence = GATATGTTATCTTGTAACATGAC

Gene: Saro_0754: Predicted zinc-regulated TonB-dependent outer membrane transporter
*
Sphingopyxis alaskensis RB2256

Site:
position = -67
score = 5.29188
sequence = TCATTGTGACAGTATATCATTAC

Gene: Sala_1894: Predicted zinc-regulated TonB-dependent outer membrane transporter
*2
Sphingobium japonicum UT26S

Site:
position = -68
score = 5.34428
sequence = GTATTGATATGCTATATCATTTC

Gene: SJA_C1-31170: Predicted zinc-regulated TonB-dependent outer membrane transporter

Site:
position = -111
score = 5.76774
sequence = GAGATGTTATCTTGTATCATCGT

Gene: SJA_C1-18900: Predicted zinc-regulated TonB-dependent outer membrane transporter
 
Sphingomonas wittichii RW1

Gene: Swit_0540: Predicted zinc-regulated TonB-dependent outer membrane transporter
 
Zymomonas mobilis subsp. mobilis ZM4
Predicted zinc-regulated TonB-dependent outer membrane transporter
 
CRON 3.
tonB1
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1
 
Novosphingobium aromaticivorans DSM 12444
*
Sphingopyxis alaskensis RB2256

Site:
position = -91
score = 5.59794
sequence = ATGACGTGATGTTATAACATCAT

Gene: Sala_2946: Ferric siderophore transport system, periplasmic binding protein TonB
*
Sphingobium japonicum UT26S

Site:
position = -88
score = 5.19871
sequence = TAAATTTAATGTTGCAACATATC

Gene: SJA_C1-02890: Ferric siderophore transport system, periplasmic binding protein TonB
*
Sphingomonas wittichii RW1

Site:
position = -70
score = 5.11565
sequence = CCATCGTAATGATGTATCATTGC

Gene: Swit_2441: Ferric siderophore transport system, periplasmic binding protein TonB
 
Zymomonas mobilis subsp. mobilis ZM4
Ferric siderophore transport system, periplasmic binding protein TonB
 
CRON 4.
tonB2
*
Erythrobacter litoralis HTCC2594

Site:
position = -85
score = 6.02872
sequence = TAGATGTTATGTTGTCACATTAC

Gene: ELI_02180: Ferric siderophore transport system, periplasmic binding protein TonB
*
Erythrobacter sp. NAP1

Site:
position = -97
score = 5.80879
sequence = CAAATGTTATGTTGCAACATTCT

Gene: NAP1_01425: Ferric siderophore transport system, periplasmic binding protein TonB
 
Novosphingobium aromaticivorans DSM 12444
 
Sphingopyxis alaskensis RB2256
 
Sphingobium japonicum UT26S
 
Sphingomonas wittichii RW1
 
Zymomonas mobilis subsp. mobilis ZM4
Ferric siderophore transport system, periplasmic binding protein TonB
 
CRON 5.
omr2
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1
 
Novosphingobium aromaticivorans DSM 12444
 
Sphingopyxis alaskensis RB2256
 
Sphingobium japonicum UT26S
 
Sphingomonas wittichii RW1
*
Zymomonas mobilis subsp. mobilis ZM4

Site:
position = -46
score = 5.98616
sequence = GAAATGTTATGTTATCACATAAC

Gene: ZMO0902: Predicted zinc-regulated TonB-dependent outer membrane transporter
Predicted zinc-regulated TonB-dependent outer membrane transporter
 
CRON 6.
feoA
 
Erythrobacter litoralis HTCC2594

Gene: ELI_00185: Ferrous iron transport protein A
 
Erythrobacter sp. NAP1
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_2850: Ferrous iron transport protein A
 
Sphingopyxis alaskensis RB2256

Gene: Sala_2986: Ferrous iron transport protein A
 
Sphingobium japonicum UT26S

Gene: SJA_C1-02970: Ferrous iron transport protein A
 
Sphingomonas wittichii RW1

Gene: Swit_2450: Ferrous iron transport protein A
*
Zymomonas mobilis subsp. mobilis ZM4

Site:
position = -186
score = 5.95884
sequence = ACATTGTTATGTTATAATATTAC

Gene: ZMO1540: Ferrous iron transport protein A
Ferrous iron transport protein A
feoB
 
Erythrobacter litoralis HTCC2594

Gene: ELI_00190: Ferrous iron transport protein B
 
Erythrobacter sp. NAP1
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_2849: Ferrous iron transport protein B
 
Sphingopyxis alaskensis RB2256

Gene: Sala_2987: Ferrous iron transport protein B
 
Sphingobium japonicum UT26S

Gene: SJA_C1-02980: Ferrous iron transport protein B
 
Sphingomonas wittichii RW1

Gene: Swit_2451: Ferrous iron transport protein B
 
Zymomonas mobilis subsp. mobilis ZM4

Gene: ZMO1541: Ferrous iron transport protein B
Ferrous iron transport protein B
 
CRON 7.
czdD
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1
 
Novosphingobium aromaticivorans DSM 12444
 
Sphingopyxis alaskensis RB2256
 
Sphingobium japonicum UT26S
 
Sphingomonas wittichii RW1
*
Zymomonas mobilis subsp. mobilis ZM4

Site:
position = -53
score = 5.27496
sequence = GTAATGTGATATTATAACTTTTG

Gene: ZMO0866: Cobalt-zinc-cadmium resistance protein CzcD
Cobalt-zinc-cadmium resistance protein CzcD
 
CRON 8.
omr3
 
Erythrobacter litoralis HTCC2594

Gene: ELI_00385: Predicted zinc-regulated TonB-dependent outer membrane transporter
 
Erythrobacter sp. NAP1

Gene: NAP1_15908: Predicted zinc-regulated TonB-dependent outer membrane transporter
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_3280: Predicted zinc-regulated TonB-dependent outer membrane transporter
 
Sphingopyxis alaskensis RB2256

Gene: Sala_2091: Predicted zinc-regulated TonB-dependent outer membrane transporter
 
Sphingobium japonicum UT26S
 
Sphingomonas wittichii RW1
*
Zymomonas mobilis subsp. mobilis ZM4

Site:
position = -154
score = 5.21969
sequence = TTAATGTTTTATTATAAAATAAT

Gene: ZMO1822: Predicted zinc-regulated TonB-dependent outer membrane transporter
Predicted zinc-regulated TonB-dependent outer membrane transporter
 
CRON 9.
PF03203
 
Erythrobacter litoralis HTCC2594

Gene: ELI_12845: MerC-like membrane protein
 
Erythrobacter sp. NAP1

Gene: NAP1_13188: MerC-like membrane protein
*
Novosphingobium aromaticivorans DSM 12444

Site:
position = -35
score = 5.45963
sequence = ACTATGTAACATTATAACATAAA

Gene: Saro_3289: MerC-like membrane protein
*
Sphingopyxis alaskensis RB2256

Site:
position = -71
score = 5.56521
sequence = ACAATGTGATGTTGTAACCTTGG

Gene: Sala_0375: MerC-like membrane protein
*
Sphingobium japonicum UT26S

Site:
position = -49
score = 5.70742
sequence = GCGATGATATGTTGTAACTTTCC

Gene: SJA_C1-07260: MerC-like membrane protein
*
Sphingomonas wittichii RW1

Site:
position = -55
score = 5.39774
sequence = GCAATGATATATTGTATCTTCGA

Gene: Swit_1463: MerC-like membrane protein
*
Zymomonas mobilis subsp. mobilis ZM4

Site:
position = -110
score = 5.03007
sequence = CCGCCGTTACGTTGTAACATATA

Gene: ZMO0885: MerC-like membrane protein
MerC-like membrane protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD