Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Zur - Rhodospirillales

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 27 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Rhodospirillum rubrum ATCC 11170 3 1
Magnetospirillum magnetotacticum MS-1 5 3
Magnetospirillum magneticum AMB-1 4 2
Azospirillum sp. B510 7 3
Rhodospirillum centenum SW 4 3
Gluconacetobacter diazotrophicus PAl 5 5 3
Acetobacter pasteurianus IFO 3283-01 5 3
Gluconobacter oxydans 621H 7 5
Granulibacter bethesdensis CGDNIH1 6 4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
znuA4
 
Rhodospirillum rubrum ATCC 11170
*
Magnetospirillum magnetotacticum MS-1

Site:
position = -52
score = 5.11313
sequence = GCGATGTGATAATGTTACATTAT

Gene: Magn03000731: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Magnetospirillum magneticum AMB-1
 
Azospirillum sp. B510
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
Zinc ABC transporter, periplasmic-binding protein ZnuA
 
CRON 2.
zur
 
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A1911: Zinc uptake regulation protein Zur
*2
Magnetospirillum magnetotacticum MS-1

Site:
position = -87
score = 6.90199
sequence = GAAATGTTATAATATAACATATC

Gene: Magn03007851: Zinc uptake regulation protein Zur

Gene: Magn03006409: Zinc uptake regulation protein Zur
*
Magnetospirillum magneticum AMB-1

Site:
position = -36
score = 6.42378
sequence = GGAATGTTATAATATAACAAATC

Gene: amb2309: Zinc uptake regulation protein Zur
 
Azospirillum sp. B510

Gene: AZL_019410: Zinc uptake regulation protein Zur
 
Rhodospirillum centenum SW

Gene: RC1_0590: Zinc uptake regulation protein Zur
*
Gluconacetobacter diazotrophicus PAl 5

Site:
position = -105
score = 5.57059
sequence = ACTATGTTATAATGTAACAAATA

Gene: Gdia_1959: Zinc uptake regulation protein Zur
*
Acetobacter pasteurianus IFO 3283-01

Site:
position = -105
score = 5.69621
sequence = GCAATGTAATACTATTACATTTT

Gene: APA01_22640: Zinc uptake regulation protein Zur
 
Gluconobacter oxydans 621H

Gene: GOX0811: Zinc uptake regulation protein Zur
 
Granulibacter bethesdensis CGDNIH1

Gene: GbCGDNIH1_1212: Zinc uptake regulation protein Zur
Zinc uptake regulation protein Zur
znuC3
 
Rhodospirillum rubrum ATCC 11170
 
Magnetospirillum magnetotacticum MS-1

Gene: Magn03007852: ABC-type Mn/Zn transport systems, ATPase component
 
Magnetospirillum magneticum AMB-1

Gene: amb2310: ABC-type Mn/Zn transport systems, ATPase component
*
Azospirillum sp. B510

Site:
position = -129
score = 5.30077
sequence = GTCACGTTATAACGTAACATGTC

Gene: AZL_d00760: ABC-type Mn/Zn transport systems, ATPase component
*
Rhodospirillum centenum SW

Site:
position = -75
score = 5.7965
sequence = AGATCGTTATATTATAACATTTG

Gene: RC1_3160: ABC-type Mn/Zn transport systems, ATPase component
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
ABC-type Mn/Zn transport systems, ATPase component
znuB3
 
Rhodospirillum rubrum ATCC 11170
 
Magnetospirillum magnetotacticum MS-1

Gene: Magn03007853: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Magnetospirillum magneticum AMB-1

Gene: amb2311: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Azospirillum sp. B510

Gene: AZL_d00750: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Rhodospirillum centenum SW

Gene: RC1_3159: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
Zinc ABC transporter, inner membrane permease protein ZnuB
 
CRON 3.
PF08856
 
Rhodospirillum rubrum ATCC 11170
 
Magnetospirillum magnetotacticum MS-1
 
Magnetospirillum magneticum AMB-1
*
Azospirillum sp. B510

Site:
position = -54
score = 5.96192
sequence = TGTACGTTATGATATAACATTAC

Gene: AZL_004800: Hypothetical protein
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
*
Gluconobacter oxydans 621H

Site:
position = -46
score = 5.36109
sequence = TGATCATTATGTTATAACATAAC

Gene: GOX2213: Hypothetical protein
*
Granulibacter bethesdensis CGDNIH1

Site:
position = -63
score = 6.12868
sequence = TGTTTGTTATGTTATAACATAAC

Gene: GbCGDNIH1_0784: Hypothetical protein
Hypothetical protein
znuC
*
Rhodospirillum rubrum ATCC 11170

Site:
position = -199
score = 6.03634
sequence = AAAATGTGATGTTATAACGTTTT

Gene: Rru_A3702: Zinc ABC transporter, ATP-binding protein ZnuC
 
Magnetospirillum magnetotacticum MS-1
 
Magnetospirillum magneticum AMB-1
 
Azospirillum sp. B510

Gene: AZL_004790: Zinc ABC transporter, ATP-binding protein ZnuC
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
*
Granulibacter bethesdensis CGDNIH1

Site:
position = -172
score = 5.94288
sequence = TATATGTTATAACATAACACAAT

Gene: GbCGDNIH1_1210: Zinc ABC transporter, ATP-binding protein ZnuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
 
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A3703: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Magnetospirillum magnetotacticum MS-1
 
Magnetospirillum magneticum AMB-1
 
Azospirillum sp. B510

Gene: AZL_004780: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1

Gene: GbCGDNIH1_1209: Zinc ABC transporter, inner membrane permease protein ZnuB
Zinc ABC transporter, inner membrane permease protein ZnuB
znuA
 
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A3704: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Magnetospirillum magnetotacticum MS-1
 
Magnetospirillum magneticum AMB-1
 
Azospirillum sp. B510

Gene: AZL_004770: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1

Gene: GbCGDNIH1_1208: Zinc ABC transporter, periplasmic-binding protein ZnuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
 
CRON 4.
znuA3
 
Rhodospirillum rubrum ATCC 11170
*
Magnetospirillum magnetotacticum MS-1

Site:
position = -53
score = 6.82648
sequence = GATATGTTATATTATAACATTTC

Gene: Magn03007850: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Magnetospirillum magneticum AMB-1

Site:
position = -53
score = 6.42504
sequence = GATTTGTTATATTATAACATTCC

Gene: amb2308: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Azospirillum sp. B510

Site:
position = -94
score = 5.90397
sequence = GACATGTTACGTTATAACGTGAC

Gene: AZL_d00770: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Rhodospirillum centenum SW

Site:
position = -70
score = 5.91634
sequence = CAAATGTTATAATATAACGATCT

Gene: RC1_3161: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
Zinc ABC transporter, periplasmic-binding protein ZnuA
 
CRON 5.
omr
 
Rhodospirillum rubrum ATCC 11170
 
Magnetospirillum magnetotacticum MS-1
 
Magnetospirillum magneticum AMB-1
 
Azospirillum sp. B510
 
Rhodospirillum centenum SW
*
Gluconacetobacter diazotrophicus PAl 5

Site:
position = -89
score = 4.58961
sequence = GAAACGTTATATCATACGGTTTA

Gene: Gdia_1456: Predicted zinc-regulated TonB-dependent outer membrane transporter
*
Acetobacter pasteurianus IFO 3283-01

Site:
position = -66
score = 5.85809
sequence = GTAATGTTATAGTGTTACATAAT

Gene: APA01_04190: Predicted zinc-regulated TonB-dependent outer membrane transporter
*
Gluconobacter oxydans 621H

Site:
position = -80
score = 6.36649
sequence = GAACTGTTATGATATAACATAAT

Gene: GOX0561: Predicted zinc-regulated TonB-dependent outer membrane transporter
*
Granulibacter bethesdensis CGDNIH1

Site:
position = -28
score = 6.12809
sequence = AACATGTCATGTTATAACATAAC

Gene: GbCGDNIH1_1357: Predicted zinc-regulated TonB-dependent outer membrane transporter
Predicted zinc-regulated TonB-dependent outer membrane transporter
 
CRON 6.
znuA2
 
Rhodospirillum rubrum ATCC 11170
 
Magnetospirillum magnetotacticum MS-1
 
Magnetospirillum magneticum AMB-1
 
Azospirillum sp. B510
 
Rhodospirillum centenum SW
*
Gluconacetobacter diazotrophicus PAl 5

Site:
position = -75
score = 5.96889
sequence = TATTTGTTACATTATAACATAGT

Gene: Gdia_1958: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Acetobacter pasteurianus IFO 3283-01

Site:
position = -42
score = 5.7826
sequence = AAAATGTAATAGTATTACATTGC

Gene: APA01_22630: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Gluconobacter oxydans 621H

Site:
position = -50
score = 5.29001
sequence = GATGTGTTACTTTATAACGCTAC

Gene: GOX1044: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Granulibacter bethesdensis CGDNIH1
Zinc ABC transporter, periplasmic-binding protein ZnuA
znuC2
 
Rhodospirillum rubrum ATCC 11170
 
Magnetospirillum magnetotacticum MS-1
 
Magnetospirillum magneticum AMB-1
 
Azospirillum sp. B510
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5

Gene: Gdia_1957: Zinc ABC transporter, ATP-binding protein ZnuC
 
Acetobacter pasteurianus IFO 3283-01

Gene: APA01_22620: Zinc ABC transporter, ATP-binding protein ZnuC
 
Gluconobacter oxydans 621H

Gene: GOX1045: Zinc ABC transporter, ATP-binding protein ZnuC
 
Granulibacter bethesdensis CGDNIH1
Zinc ABC transporter, ATP-binding protein ZnuC
znuB2
 
Rhodospirillum rubrum ATCC 11170
 
Magnetospirillum magnetotacticum MS-1
 
Magnetospirillum magneticum AMB-1
 
Azospirillum sp. B510
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5

Gene: Gdia_1956: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Acetobacter pasteurianus IFO 3283-01

Gene: APA01_22610: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Gluconobacter oxydans 621H

Gene: GOX1046: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Granulibacter bethesdensis CGDNIH1
Zinc ABC transporter, inner membrane permease protein ZnuB
 
CRON 7.
omr1
 
Rhodospirillum rubrum ATCC 11170
 
Magnetospirillum magnetotacticum MS-1
 
Magnetospirillum magneticum AMB-1
 
Azospirillum sp. B510
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5

Gene: Gdia_1977: Predicted zinc-regulated TonB-dependent outer membrane transporter
 
Acetobacter pasteurianus IFO 3283-01

Gene: APA01_05630: Predicted zinc-regulated TonB-dependent outer membrane transporter
*
Gluconobacter oxydans 621H

Site:
position = -178
score = 5.554
sequence = ATTATGTTATATCATAACAGTTC

Gene: GOX0562: Predicted zinc-regulated TonB-dependent outer membrane transporter
 
Granulibacter bethesdensis CGDNIH1
Predicted zinc-regulated TonB-dependent outer membrane transporter
 
CRON 8.
omr2
 
Rhodospirillum rubrum ATCC 11170
 
Magnetospirillum magnetotacticum MS-1
 
Magnetospirillum magneticum AMB-1
 
Azospirillum sp. B510
*
Rhodospirillum centenum SW

Site:
position = -65
score = 5.20842
sequence = GATACGTTATAACATCACGTACC

Gene: RC1_3938: Predicted zinc-regulated TonB-dependent outer membrane transporter
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
Predicted zinc-regulated TonB-dependent outer membrane transporter
 
CRON 9.
yciC
 
Rhodospirillum rubrum ATCC 11170
 
Magnetospirillum magnetotacticum MS-1
 
Magnetospirillum magneticum AMB-1
 
Azospirillum sp. B510
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
*
Gluconobacter oxydans 621H

Site:
position = -73
score = 6.13451
sequence = CGATTGTTATGTTATAACATAAT

Gene: GOX2212: Putative zinc chaperone, COG0523 family
*
Granulibacter bethesdensis CGDNIH1

Site:
position = -57
score = 6.37887
sequence = TAAACGTTATGTTATAACATAAC

Gene: GbCGDNIH1_1545: Putative zinc chaperone, COG0523 family
Putative zinc chaperone, COG0523 family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD