Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Zur - Rhodobacterales

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 36 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Rhodobacter sphaeroides 2.4.1 5 3
Paracoccus denitrificans PD1222 5 3
Jannaschia sp. CCS1 4 2
Rhodobacterales bacterium HTCC2654 4 2
Oceanicola granulosus HTCC2516 4 2
Loktanella vestfoldensis SKA53 4 2
Oceanicola batsensis HTCC2597 6 3
Roseovarius nubinhibens ISM 6 4
Roseovarius sp. 217 4 2
Sulfitobacter sp. EE-36 5 3
Silicibacter TM1040 6 4
Silicibacter pomeroyi DSS-3 4 2
Roseobacter sp. MED193 4 2
Hyphomonas neptunium ATCC 15444 1 1
Oceanicaulis alexandrii HTCC2633 1 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
zur
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -24
score = 5.68874
sequence = ATTACGTTATATCATAACGCGTC

Gene: RSP_3569: Zinc uptake regulation protein Zur
*
Paracoccus denitrificans PD1222

Site:
position = -49
score = 5.31371
sequence = TTTATGTTATATCGTAACCCGTC

Gene: Pden_4139: Zinc uptake regulation protein Zur
*
Jannaschia sp. CCS1

Site:
position = -18
score = 5.18003
sequence = TAACTGATATGAAATAACATGAC

Gene: Jann_0313: Zinc uptake regulation protein Zur
*
Rhodobacterales bacterium HTCC2654

Site:
position = -35
score = 5.45566
sequence = TATCTGTAATATCATAACGCATC

Gene: RB2654_20873: Zinc uptake regulation protein Zur
*
Oceanicola granulosus HTCC2516

Site:
position = -35
score = 5.66994
sequence = GAGATGTTATAACGTAACAACCC

Gene: OG2516_06067: Zinc uptake regulation protein Zur
*
Loktanella vestfoldensis SKA53

Site:
position = -29
score = 6.00744
sequence = GATATGTTATATCATAACAAGGC

Gene: SKA53_01416: Zinc uptake regulation protein Zur
*
Oceanicola batsensis HTCC2597

Site:
position = -55
score = 5.26311
sequence = TTCCTGTTATAAGATAACATTGC

Gene: OB2597_14481: Zinc uptake regulation protein Zur
*
Roseovarius nubinhibens ISM

Site:
position = -54
score = 5.63892
sequence = TAGATGAGATAATATAACATATC

Gene: ISM_14175: Zinc uptake regulation protein Zur
*
Roseovarius sp. 217

Site:
position = -98
score = 5.50582
sequence = CATATGTGATATCATAACATTCA

Gene: ROS217_23042: Zinc uptake regulation protein Zur
*
Sulfitobacter sp. EE-36

Site:
position = -47
score = 5.48231
sequence = CACACGTTATAACATATCAACAC

Gene: EE36_13033: Zinc uptake regulation protein Zur
*
Silicibacter TM1040

Site:
position = -86
score = 5.48256
sequence = CTGGTGTTATATCATAACGTTAT

Gene: TM1040_3615: Zinc uptake regulation protein Zur
*
Silicibacter pomeroyi DSS-3

Site:
position = -45
score = 5.59122
sequence = GGGATGTTATAACATATCAAGCC

Gene: SPO0986: Zinc uptake regulation protein Zur
*
Roseobacter sp. MED193

Site:
position = -111
score = 5.56808
sequence = CTCATGTAATTTTATAACATCTC

Gene: MED193_01515: Zinc uptake regulation protein Zur
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_0655: Zinc uptake regulation protein Zur
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_05994: Zinc uptake regulation protein Zur
Zinc uptake regulation protein Zur
znuC
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_3568: Zinc ABC transporter, ATP-binding protein ZnuC
 
Paracoccus denitrificans PD1222

Gene: Pden_4138: Zinc ABC transporter, ATP-binding protein ZnuC
 
Jannaschia sp. CCS1

Gene: Jann_0314: Zinc ABC transporter, ATP-binding protein ZnuC
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_20878: Zinc ABC transporter, ATP-binding protein ZnuC
 
Oceanicola granulosus HTCC2516

Gene: OG2516_06062: Zinc ABC transporter, ATP-binding protein ZnuC
 
Loktanella vestfoldensis SKA53

Gene: SKA53_01421: Zinc ABC transporter, ATP-binding protein ZnuC
 
Oceanicola batsensis HTCC2597

Gene: OB2597_14486: Zinc ABC transporter, ATP-binding protein ZnuC
 
Roseovarius nubinhibens ISM

Gene: ISM_14170: Zinc ABC transporter, ATP-binding protein ZnuC
 
Roseovarius sp. 217

Gene: ROS217_23047: Zinc ABC transporter, ATP-binding protein ZnuC
 
Sulfitobacter sp. EE-36

Gene: EE36_13028: Zinc ABC transporter, ATP-binding protein ZnuC
 
Silicibacter TM1040

Gene: TM1040_3614: Zinc ABC transporter, ATP-binding protein ZnuC
 
Silicibacter pomeroyi DSS-3

Gene: SPO0985: Zinc ABC transporter, ATP-binding protein ZnuC
 
Roseobacter sp. MED193

Gene: MED193_01510: Zinc ABC transporter, ATP-binding protein ZnuC
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_3567: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Paracoccus denitrificans PD1222

Gene: Pden_4137: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Jannaschia sp. CCS1

Gene: Jann_0315: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_20883: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Oceanicola granulosus HTCC2516

Gene: OG2516_06057: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Loktanella vestfoldensis SKA53

Gene: SKA53_01426: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Oceanicola batsensis HTCC2597

Gene: OB2597_14491: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Roseovarius nubinhibens ISM

Gene: ISM_14165: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Roseovarius sp. 217

Gene: ROS217_23052: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Sulfitobacter sp. EE-36

Gene: EE36_13023: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Silicibacter TM1040

Gene: TM1040_3613: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Silicibacter pomeroyi DSS-3

Gene: SPO0984: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Roseobacter sp. MED193

Gene: MED193_01505: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Zinc ABC transporter, inner membrane permease protein ZnuB
 
CRON 2.
znuA
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -55
score = 5.38708
sequence = GACGCGTTATGATATAACGTAAT

Gene: RSP_3571: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Paracoccus denitrificans PD1222

Site:
position = -83
score = 5.41792
sequence = ATGATGTTATATCGTTACATTTT

Gene: Pden_4140: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Jannaschia sp. CCS1

Site:
position = -61
score = 5.3734
sequence = GTCATGTTATTTCATATCAGTTA

Gene: Jann_0312: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Rhodobacterales bacterium HTCC2654

Site:
position = -59
score = 5.24343
sequence = GATGCGTTATGATATTACAGATA

Gene: RB2654_20868: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Oceanicola granulosus HTCC2516

Site:
position = -63
score = 5.08839
sequence = GGGTTGTTACGTTATAACATCTC

Gene: OG2516_06072: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Loktanella vestfoldensis SKA53

Site:
position = -63
score = 5.69206
sequence = GCCTTGTTATGATATAACATATC

Gene: SKA53_01411: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Oceanicola batsensis HTCC2597

Site:
position = -30
score = 5.20775
sequence = GCAATGTTATCTTATAACAGGAA

Gene: OB2597_14476: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Roseovarius nubinhibens ISM

Site:
position = -115
score = 5.50557
sequence = GATATGTTATATTATCTCATCTA

Gene: ISM_14180: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Roseovarius sp. 217

Site:
position = -32
score = 5.28037
sequence = TGAATGTTATGATATCACATATG

Gene: ROS217_23037: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Sulfitobacter sp. EE-36

Site:
position = -64
score = 5.27605
sequence = GTGTTGATATGTTATAACGTGTG

Gene: EE36_13038: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Silicibacter TM1040

Site:
position = -36
score = 5.28632
sequence = ATAACGTTATGATATAACACCAG

Gene: TM1040_3616: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Silicibacter pomeroyi DSS-3

Site:
position = -65
score = 5.21105
sequence = GGCTTGATATGTTATAACATCCC

Gene: SPO0987: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Roseobacter sp. MED193

Site:
position = -66
score = 5.55941
sequence = GAGATGTTATAAAATTACATGAG

Gene: MED193_01520: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Zinc ABC transporter, periplasmic-binding protein ZnuA
 
CRON 3.
zinT
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -62
score = 5.9104
sequence = GATATGTAATAACATATCATATA

Gene: RSP_3117: Candidate zinc-binding lipoprotein ZinT
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
*
Roseovarius nubinhibens ISM

Site:
position = -34
score = 5.21682
sequence = GCTACGTTATATCATAACTACTT

Gene: ISM_05645: Candidate zinc-binding lipoprotein ZinT
 
Roseovarius sp. 217
*
Sulfitobacter sp. EE-36

Site:
position = -54
score = 6.05123
sequence = GTTACGTTATAACATAACGAATC

Gene: EE36_11254: Candidate zinc-binding lipoprotein ZinT
*
Silicibacter TM1040

Site:
position = -36
score = 5.6168
sequence = AACGTGTTATAACATAACGAATC

Gene: TM1040_0201: Candidate zinc-binding lipoprotein ZinT
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Candidate zinc-binding lipoprotein ZinT
 
CRON 4.
trxR
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1

Gene: Jann_2255: Thioredoxin reductase (EC 1.8.1.9)
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
*
Oceanicola batsensis HTCC2597

Site:
position = -116
score = 4.96429
sequence = GTAACGTGATATCATAACCACAT

Gene: OB2597_20976: Thioredoxin reductase (EC 1.8.1.9)
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Thioredoxin reductase (EC 1.8.1.9)
yciC
 
Rhodobacter sphaeroides 2.4.1
*
Paracoccus denitrificans PD1222

Site:
position = -33
score = 5.69029
sequence = GTAACGTAATAACATTACATTTA

Gene: Pden_1338: Putative zinc chaperone, COG0523 family
 
Jannaschia sp. CCS1

Gene: Jann_2254: Putative zinc chaperone, COG0523 family
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597

Gene: OB2597_20981: Putative zinc chaperone, COG0523 family
*
Roseovarius nubinhibens ISM

Site:
position = -71
score = 5.40966
sequence = GTGATGTTATACTATAACAGATT

Gene: ISM_00325: Putative zinc chaperone, COG0523 family
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
*
Silicibacter TM1040

Site:
position = -38
score = 5.37873
sequence = TGATTGTTATCTTATAACATTTC

Gene: TM1040_0080: Putative zinc chaperone, COG0523 family
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Putative zinc chaperone, COG0523 family
 
CRON 5.
omr
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
*
Hyphomonas neptunium ATCC 15444

Site:
position = -44
score = 5.35347
sequence = GTAATGCAATATTATTACATTAC

Gene: HNE_1973: Predicted zinc-regulated TonB-dependent outer membrane transporter
*
Oceanicaulis alexandrii HTCC2633

Site:
position = -52
score = 5.72644
sequence = GTGACGTTATGACATTACGTAAC

Gene: OA2633_05989: Predicted zinc-regulated TonB-dependent outer membrane transporter
Predicted zinc-regulated TonB-dependent outer membrane transporter
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD