Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Zur - Rhizobiales

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 42 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Sinorhizobium meliloti 1021 5 3
Rhizobium sp. NGR234 4 2
Rhizobium leguminosarum bv. viciae 3841 10 5
Rhizobium etli CFN 42 11 6
Agrobacterium tumefaciens str. C58 (Cereon) 10 6
Mesorhizobium sp. BNC1 4 2
Mesorhizobium loti MAFF303099 3 1
Brucella melitensis 16M 5 2
Bartonella quintana str. Toulouse 3 1
Rhodopseudomonas palustris CGA009 8 3
Bradyrhizobium japonicum USDA 110 7 2
Bradyrhizobium sp. BTAi1 9 4
Nitrobacter winogradskyi Nb-255 7 2
Azorhizobium caulinodans ORS 571
Xanthobacter autotrophicus Py2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
PF11162
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
*
Rhodopseudomonas palustris CGA009

Site:
position = -44
score = 5.2023
sequence = GCAATGTTACTTTATAACATCGG

Gene: RPA4384: Conserved hypothetical protein
*
Bradyrhizobium japonicum USDA 110

Site:
position = -3
score = 5.32466
sequence = GCGATGTTACATTATAACATCGC

Gene: bll2461: Conserved hypothetical protein
*
Bradyrhizobium sp. BTAi1

Site:
position = -75
score = 4.57107
sequence = GCGATGTTACTTTGTAACAATGG

Gene: BBta_2267: Conserved hypothetical protein
*
Nitrobacter winogradskyi Nb-255

Site:
position = -65
score = 5.26124
sequence = CAGGCGTTATATTATAACATCCG

Gene: Nwi_2630: Conserved hypothetical protein
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Conserved hypothetical protein
omr
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA4385: Predicted zinc-regulated TonB-dependent outer membrane transporter
 
Bradyrhizobium japonicum USDA 110

Gene: bll2460: Predicted zinc-regulated TonB-dependent outer membrane transporter
 
Bradyrhizobium sp. BTAi1

Gene: BBta_2266: Predicted zinc-regulated TonB-dependent outer membrane transporter
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_2631: Predicted zinc-regulated TonB-dependent outer membrane transporter
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Predicted zinc-regulated TonB-dependent outer membrane transporter
 
CRON 2.
zinT
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
*
Rhizobium etli CFN 42

Site:
position = -74
score = 5.35849
sequence = GTAATGTTATTACATTACGGACT

Gene: RHE_PF00158: Candidate zinc-binding lipoprotein ZinT
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -58
score = 6.11983
sequence = GAAATGTAATGTTATTACGTTAC

Gene: Atu1049: Candidate zinc-binding lipoprotein ZinT
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Candidate zinc-binding lipoprotein ZinT
 
CRON 3.
znuA2
*
Sinorhizobium meliloti 1021

Site:
position = -86
score = 5.50665
sequence = TTGATGTAATAACATAACAACGC

Gene: SMc04245: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Rhizobium sp. NGR234

Site:
position = -204
score = 5.40185
sequence = TTGATGTAATAACATTACGTGCA

Gene: NGR_c17650: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -89
score = 5.65781
sequence = TTGATGTAATAACATAACAATTG

Gene: RL3178: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Rhizobium etli CFN 42

Site:
position = -43
score = 5.46844
sequence = TCAATGTAATAACATAACACTCG

Gene: RHE_CH02712: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -45
score = 5.63137
sequence = TAAATGTAATAACATAACTATAC

Gene: Atu1521: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Mesorhizobium sp. BNC1

Site:
position = -105
score = 5.62429
sequence = CAAGTGTAATGTCATAACGTTTA

Gene: Meso_4006: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Mesorhizobium loti MAFF303099
*
Brucella melitensis 16M

Site:
position = -106
score = 5.26909
sequence = CAGACGTTATAGCATAACGTAAT

Gene: BMEII0178: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Zinc ABC transporter, periplasmic-binding protein ZnuA
yciC2
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -44
score = 6.20834
sequence = CAAATGTAATGATATAACATAAA

Gene: RL3179: Putative Putative zinc chaperone, COG0523 family
*
Rhizobium etli CFN 42

Site:
position = -39
score = 6.00065
sequence = GACATGTAATGATATAACATTAA

Gene: RHE_CH02713: Putative Putative zinc chaperone, COG0523 family
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -120
score = 5.90585
sequence = CATATGTAATGTTATTACGTTAC

Site:
position = -262
score = 5.88427
sequence = GATATGTAATGTTATTACATTCG

Gene: Atu3181: Putative Putative zinc chaperone, COG0523 family
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M

Gene: BMEII0179: Putative Putative zinc chaperone, COG0523 family
 
Bartonella quintana str. Toulouse
*
Rhodopseudomonas palustris CGA009

Site:
position = -65
score = 5.82893
sequence = TTTATGTAATGTTATAACGTTTC

Gene: RPA1462: Putative Putative zinc chaperone, COG0523 family
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Putative Putative zinc chaperone, COG0523 family
 
CRON 4.
znuC2
*
Sinorhizobium meliloti 1021

Site:
position = -114
score = 5.55909
sequence = GCGTTGTTATGTTATTACATCAA

Gene: SMc04244: Zinc ABC transporter, ATP-binding protein ZnuC
*
Rhizobium sp. NGR234

Site:
position = -8
score = 5.26846
sequence = TGCACGTAATGTTATTACATCAA

Gene: NGR_c17640: Zinc ABC transporter, ATP-binding protein ZnuC
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -81
score = 5.83064
sequence = CAATTGTTATGTTATTACATCAA

Gene: RL3177: Zinc ABC transporter, ATP-binding protein ZnuC
*
Rhizobium etli CFN 42

Site:
position = -81
score = 5.43159
sequence = CGAGTGTTATGTTATTACATTGA

Gene: RHE_CH02711: Zinc ABC transporter, ATP-binding protein ZnuC
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -82
score = 5.48887
sequence = GTATAGTTATGTTATTACATTTA

Gene: Atu1520: Zinc ABC transporter, ATP-binding protein ZnuC
*
Mesorhizobium sp. BNC1

Site:
position = -77
score = 5.46297
sequence = TAAACGTTATGACATTACACTTG

Gene: Meso_4005: Zinc ABC transporter, ATP-binding protein ZnuC
 
Mesorhizobium loti MAFF303099
*
Brucella melitensis 16M

Site:
position = -183
score = 5.39146
sequence = GATATGTTATTTTATTACGCAAA

Gene: BMEII0177: Zinc ABC transporter, ATP-binding protein ZnuC
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Zinc ABC transporter, ATP-binding protein ZnuC
znuB2
 
Sinorhizobium meliloti 1021

Gene: SMc04243: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Rhizobium sp. NGR234

Gene: NGR_c17630: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL3176: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Rhizobium etli CFN 42

Gene: RHE_CH02710: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu1519: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Mesorhizobium sp. BNC1

Gene: Meso_4004: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M

Gene: BMEII0176: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Zinc ABC transporter, inner membrane permease protein ZnuB
zur
 
Sinorhizobium meliloti 1021

Gene: SMc04242: Zinc uptake regulation protein Zur
 
Rhizobium sp. NGR234

Gene: NGR_c17620: Zinc uptake regulation protein Zur
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL3175: Zinc uptake regulation protein Zur
 
Rhizobium etli CFN 42

Gene: RHE_CH02709: Zinc uptake regulation protein Zur
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu1518: Zinc uptake regulation protein Zur
 
Mesorhizobium sp. BNC1

Gene: Meso_4003: Zinc uptake regulation protein Zur
 
Mesorhizobium loti MAFF303099

Gene: mll3299: Zinc uptake regulation protein Zur
 
Brucella melitensis 16M

Gene: BMEII0175: Zinc uptake regulation protein Zur
 
Bartonella quintana str. Toulouse

Gene: BQ10010: Zinc uptake regulation protein Zur
 
Rhodopseudomonas palustris CGA009

Gene: RPA0517: Zinc uptake regulation protein Zur
 
Bradyrhizobium japonicum USDA 110

Gene: blr0934: Zinc uptake regulation protein Zur
 
Bradyrhizobium sp. BTAi1

Gene: BBta_7635: Zinc uptake regulation protein Zur
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_0493: Zinc uptake regulation protein Zur
 
Azorhizobium caulinodans ORS 571

Gene: AZC_4579: Zinc uptake regulation protein Zur
 
Xanthobacter autotrophicus Py2

Gene: Xaut_1888: Zinc uptake regulation protein Zur
Zinc uptake regulation protein Zur
 
CRON 5.
znuC
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -158
score = 5.37613
sequence = TAACCGTAATGTTATTACATTGT

Gene: RL1047: Zinc ABC transporter, ATP-binding protein ZnuC
*
Rhizobium etli CFN 42

Site:
position = -174
score = 5.42632
sequence = TAATCGTTATAACATAACAGTAA

Gene: RHE_CH00969: Zinc ABC transporter, ATP-binding protein ZnuC
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -203
score = 5.84892
sequence = GTAACGTAATAACATTACATATG

Site:
position = -91
score = 5.86667
sequence = TTAATGTTATTTCATTACATATT

Site:
position = -61
score = 5.8066
sequence = CGAATGTAATAACATTACATATC

Gene: Atu3180: Zinc ABC transporter, ATP-binding protein ZnuC
 
Mesorhizobium sp. BNC1
*
Mesorhizobium loti MAFF303099

Site:
position = -69
score = 5.7527
sequence = CTAATGTAATAACATCACATATC

Gene: mll8315: Zinc ABC transporter, ATP-binding protein ZnuC
 
Brucella melitensis 16M
*
Bartonella quintana str. Toulouse

Site:
position = -56
score = 6.24658
sequence = CAAATGTTATATTATTACATAAC

Gene: BQ01790: Zinc ABC transporter, ATP-binding protein ZnuC
*
Rhodopseudomonas palustris CGA009

Site:
position = -248
score = 5.07069
sequence = ATAATGTTATAATGTAACAGGTT

Gene: RPA0858: Zinc ABC transporter, ATP-binding protein ZnuC
*
Bradyrhizobium japonicum USDA 110

Site:
position = -259
score = 5.85877
sequence = GTAATGTTATAATATAACGTCCA

Gene: bll7771: Zinc ABC transporter, ATP-binding protein ZnuC
*
Bradyrhizobium sp. BTAi1

Site:
position = -271
score = 5.64587
sequence = ATGATGTTATAATGTAACATTAT

Gene: BBta_1339: Zinc ABC transporter, ATP-binding protein ZnuC
*
Nitrobacter winogradskyi Nb-255

Site:
position = -252
score = 5.47562
sequence = GTGATGTTATAATATAACGGTCG

Gene: Nwi_0914: Zinc ABC transporter, ATP-binding protein ZnuC
 
Azorhizobium caulinodans ORS 571

Gene: AZC_0562: Zinc ABC transporter, ATP-binding protein ZnuC
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4707: Zinc ABC transporter, ATP-binding protein ZnuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1048: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Rhizobium etli CFN 42

Gene: RHE_CH00970: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu3179: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099

Gene: mll8314: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse

Gene: BQ01780: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Rhodopseudomonas palustris CGA009

Gene: RPA0859: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Bradyrhizobium japonicum USDA 110

Gene: bll7770: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Bradyrhizobium sp. BTAi1

Gene: BBta_1340: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_0915: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Azorhizobium caulinodans ORS 571

Gene: AZC_0563: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4708: Zinc ABC transporter, inner membrane permease protein ZnuB
Zinc ABC transporter, inner membrane permease protein ZnuB
znuA
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1049: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Rhizobium etli CFN 42

Gene: RHE_CH00971: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu3178: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099

Gene: mll8313: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse

Gene: BQ01770: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Rhodopseudomonas palustris CGA009

Gene: RPA0860: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Bradyrhizobium japonicum USDA 110

Gene: bll7769: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Bradyrhizobium sp. BTAi1

Gene: BBta_1341: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_0916: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Azorhizobium caulinodans ORS 571

Gene: AZC_0564: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4709: Zinc ABC transporter, periplasmic-binding protein ZnuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
yciC
*2
Sinorhizobium meliloti 1021

Site:
position = -101
score = 5.27392
sequence = GCTATGTTACGTTATTACGTTTA

Gene: SMc03799: Putative zinc chaperone, COG0523 family

Gene: SMc02978: Putative zinc chaperone, COG0523 family
 
Rhizobium sp. NGR234
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -124
score = 5.311
sequence = GCGATGTGATCTTATAACATTAT

Gene: RL4148: Putative zinc chaperone, COG0523 family
*
Rhizobium etli CFN 42

Site:
position = -122
score = 5.34773
sequence = GCAATGTGATCTTATAACATATA

Gene: RHE_CH03625: Putative zinc chaperone, COG0523 family
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -142
score = 5.41587
sequence = ATAACGTTATTTCATAACAAAAT

Gene: Atu4502: Putative zinc chaperone, COG0523 family
 
Mesorhizobium sp. BNC1

Gene: Meso_2842: Putative zinc chaperone, COG0523 family
 
Mesorhizobium loti MAFF303099

Gene: mll5156: Putative zinc chaperone, COG0523 family
 
Brucella melitensis 16M

Gene: BMEII0308: Putative zinc chaperone, COG0523 family
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA0861: Putative zinc chaperone, COG0523 family
 
Bradyrhizobium japonicum USDA 110

Gene: bll7768: Putative zinc chaperone, COG0523 family
*3
Bradyrhizobium sp. BTAi1

Gene: BBta_1342: Putative zinc chaperone, COG0523 family

Site:
position = -260
score = 5.60061
sequence = ATTTTGTAATGTTATAACATCAC

Gene: BBta_2276: Putative zinc chaperone, COG0523 family

Site:
position = -87
score = 6.00664
sequence = ATGATGTTATGTTATAACATAAC

Gene: BBta_2203: Putative zinc chaperone, COG0523 family
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_0917: Putative zinc chaperone, COG0523 family
 2
Azorhizobium caulinodans ORS 571

Gene: AZC_0565: Putative zinc chaperone, COG0523 family

Gene: AZC_1103: Putative zinc chaperone, COG0523 family
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4710: Putative zinc chaperone, COG0523 family
Putative zinc chaperone, COG0523 family
PF00400
 
Sinorhizobium meliloti 1021

Gene: SMc02979: Conserved hypothetical protein
 
Rhizobium sp. NGR234

Gene: NGR_c29220: Conserved hypothetical protein
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL4149: Conserved hypothetical protein
 
Rhizobium etli CFN 42

Gene: RHE_CH03626: Conserved hypothetical protein
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4501: Conserved hypothetical protein
 
Mesorhizobium sp. BNC1

Gene: Meso_2841: Conserved hypothetical protein
 
Mesorhizobium loti MAFF303099

Gene: mll5154: Conserved hypothetical protein
 
Brucella melitensis 16M

Gene: BMEII0307: Conserved hypothetical protein
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA0862: Conserved hypothetical protein
 
Bradyrhizobium japonicum USDA 110

Gene: bll7767: Conserved hypothetical protein
 
Bradyrhizobium sp. BTAi1

Gene: BBta_1343: Conserved hypothetical protein
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_0918: Conserved hypothetical protein
 
Azorhizobium caulinodans ORS 571

Gene: AZC_0287: Conserved hypothetical protein
 
Xanthobacter autotrophicus Py2

Gene: Xaut_2131: Conserved hypothetical protein
Conserved hypothetical protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD