Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Zur - Various betaproteobacteria

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Azoarcus sp. EbN1 5 1
Thauera sp. MZ1T 9 2
Dechloromonas aromatica RCB
Nitrosomonas europaea ATCC 19718 1 1
Nitrosospira multiformis ATCC 25196 3 1
Thiobacillus denitrificans
Chromobacterium violaceum ATCC 12472
Neisseria meningitidis MC58
Laribacter hongkongensis HLHK9
Methylobacillus flagellatus KT 10 3
Methylotenera mobilis JLW8
Methylophilales bacterium HTCC2181
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
omr
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
*
Methylobacillus flagellatus KT

Site:
position = -11
score = 6.39724
sequence = AATATGCCACAATGTTGCATTAC

Gene: Mfla_0708: Predicted zinc-related TonB-dependent outer membrane transporter
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Predicted zinc-related TonB-dependent outer membrane transporter
zip
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT

Gene: Mfla_0707: Zinc transporter, ZIP family
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Zinc transporter, ZIP family
PF10986
 
Azoarcus sp. EbN1
*
Thauera sp. MZ1T

Site:
position = -99
score = 6.36925
sequence = TTGATGCAACATTGTAGCATTAG

Gene: Tmz1t_3495: Predicted ABC transport system, substrate-binding protein
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT

Gene: Mfla_0706: Predicted ABC transport system, substrate-binding protein
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Predicted ABC transport system, substrate-binding protein
COG1124
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T

Gene: Tmz1t_3494: Predicted ABC transport system, ATP-binding protein
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT

Gene: Mfla_0705: Predicted ABC transport system, ATP-binding protein
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Predicted ABC transport system, ATP-binding protein
COG0577
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T

Gene: Tmz1t_3493: Predicted ABC transport system, permease protein
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT

Gene: Mfla_0704: Predicted ABC transport system, permease protein
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Predicted ABC transport system, permease protein
PF11736
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T

Gene: Tmz1t_3492: Lipoprotein, putative
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT

Gene: Mfla_0703: Lipoprotein, putative
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Lipoprotein, putative
 
CRON 2.
dksA2
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans

Gene: Tbd_2533: DnaK suppressor protein
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
*
Methylobacillus flagellatus KT

Site:
position = -34
score = 7.00683
sequence = AAAATGCAACATTGTTGCATTAT

Site:
position = -72
score = 6.59421
sequence = TAATTGCAACATAGTTGCATATA

Gene: Mfla_1232: DnaK suppressor protein
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
DnaK suppressor protein
yciC2
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans

Gene: Tbd_2534: Putative zinc chaperone, COG0523 family
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT

Gene: Mfla_1231: Putative zinc chaperone, COG0523 family
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Putative zinc chaperone, COG0523 family
yciC3
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT

Gene: Mfla_1230: Putative zinc chaperone, COG0523 family
 
Methylotenera mobilis JLW8

Gene: Mmol_1305: Putative zinc chaperone, COG0523 family
 
Methylophilales bacterium HTCC2181
Putative zinc chaperone, COG0523 family
 
CRON 3.
zur
*
Azoarcus sp. EbN1

Site:
position = 2
score = 6.76534
sequence = GAAATGCTACAATGTTGCATTAG

Gene: ebA1809: Zinc uptake regulation protein Zur
*
Thauera sp. MZ1T

Site:
position = -81
score = 6.50627
sequence = CTAATGCTACAATGTTGCATCAA

Gene: Tmz1t_3496: Zinc uptake regulation protein Zur
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718

Gene: NE1722: Zinc uptake regulation protein Zur
*
Nitrosospira multiformis ATCC 25196

Site:
position = 145
score = 4.93381
sequence = TAAATGCAACTCTGTTGCAAACT

Gene: Nmul_A2512: ferric uptake regulator, FUR family
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT

Gene: Mfla_1233: Zinc uptake regulation protein Zur
 
Methylotenera mobilis JLW8

Gene: Mmol_1304: Zinc uptake regulation protein Zur
 
Methylophilales bacterium HTCC2181
Zinc uptake regulation protein Zur
Tmz1t_3497
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T

Gene: Tmz1t_3497: Hypothetical protein
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Hypothetical protein
znuC
 
Azoarcus sp. EbN1

Gene: ebA1812: Zinc ABC transporter, ATP-binding protein ZnuC
 
Thauera sp. MZ1T

Gene: Tmz1t_3498: Zinc ABC transporter, ATP-binding protein ZnuC
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472

Gene: CV3066: Zinc ABC transporter, ATP-binding protein ZnuC
 
Neisseria meningitidis MC58

Gene: NMB0588: Zinc ABC transporter, ATP-binding protein ZnuC
 
Laribacter hongkongensis HLHK9

Gene: LHK_01347: Zinc ABC transporter, ATP-binding protein ZnuC
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
 
Azoarcus sp. EbN1

Gene: ebA1813: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Thauera sp. MZ1T

Gene: Tmz1t_3499: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472

Gene: CV3065: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Neisseria meningitidis MC58

Gene: NMB0587: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Laribacter hongkongensis HLHK9

Gene: LHK_01348: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Zinc ABC transporter, inner membrane permease protein ZnuB
znuA
 
Azoarcus sp. EbN1

Gene: ebA1814: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Thauera sp. MZ1T

Gene: Tmz1t_3500: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472

Gene: CV3064: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Neisseria meningitidis MC58

Gene: NMB0586: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Laribacter hongkongensis HLHK9

Gene: LHK_01349: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Zinc ABC transporter, periplasmic-binding protein ZnuA
ebA1811
 
Azoarcus sp. EbN1

Gene: ebA1811: Hypothetical protein
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Hypothetical protein
Nmul_A2511
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196

Gene: Nmul_A2511: hypothetical protein
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
hypothetical protein
omr2
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
*
Nitrosomonas europaea ATCC 19718

Site:
position = -193
score = 6.39209
sequence = TAATTGCAACAATGTTGCGGCTA

Site:
position = -233
score = 6.59734
sequence = TAATTGCAACATAGTTGCGTTTT

Gene: NE1721: Predicted zinc-related TonB-dependent outer membrane transporter
 
Nitrosospira multiformis ATCC 25196

Gene: Nmul_A2510: Predicted zinc-related TonB-dependent outer membrane transporter
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Predicted zinc-related TonB-dependent outer membrane transporter
 
CRON 4.
rpmJ2
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58

Gene: NMB0941: 50S ribosomal protein L36 paralog
 
Laribacter hongkongensis HLHK9
*
Methylobacillus flagellatus KT

Site:
position = -73
score = 6.13483
sequence = AATATGCAACAATGTTGCAATTT

Gene: Mfla_1288: 50S ribosomal protein L36 paralog
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
50S ribosomal protein L36 paralog
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD