Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Zur - Comamonadaceae

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acidovorax avenae subsp. citrulli AAC00-1 7 1
Acidovorax sp. JS42
Comamonas testosteroni KF-1
Delftia acidovorans SPH-1 4 1
Polaromonas naphthalenivorans CJ2 8 2
Polaromonas sp. JS666 7 1
Rhodoferax ferrireducens DSM 15236 4 2
Variovorax paradoxus S110
Verminephrobacter eiseniae EF01-2
Methylibium petroleiphilum PM1
Leptothrix cholodnii SP-6
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
zur
*
Acidovorax avenae subsp. citrulli AAC00-1

Site:
position = -50
score = 6.83864
sequence = ATAATGCAACACGATTGCATTAA

Gene: Aave_2813: Zinc uptake regulation protein Zur
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
*
Delftia acidovorans SPH-1

Site:
position = -72
score = 6.85897
sequence = ATAATGCAACCCGGTTGCGATAA

Gene: Daci_3951: Zinc uptake regulation protein Zur
*
Polaromonas naphthalenivorans CJ2

Site:
position = -77
score = 6.50607
sequence = ATAATGCAACCTGATTGCGATAG

Site:
position = -45
score = 6.63858
sequence = GTAACGCAACTGAATTGCATTAA

Gene: Pnap_1145: Zinc uptake regulation protein Zur
*
Polaromonas sp. JS666

Site:
position = 27
score = 6.95651
sequence = ATAATGCAACTAGATTGCGTTAT

Gene: Bpro_1677: Zinc uptake regulation protein Zur
*
Rhodoferax ferrireducens DSM 15236

Site:
position = -81
score = 6.89298
sequence = ATAATGCAACTGAATTGCGATAT

Site:
position = -55
score = 6.80061
sequence = TTAACGCAACTCAATTGCAATAA

Gene: Rfer_2054: Zinc uptake regulation protein Zur
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Zinc uptake regulation protein Zur
COG2884
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2812: ABC transporter-related protein
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_1146: ABC transporter-related protein
 
Polaromonas sp. JS666

Gene: Bpro_1678: ABC transporter-related protein
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_1564: ABC transporter-related protein
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_3395: ABC transporter-related protein
 
Methylibium petroleiphilum PM1

Gene: Mpe_A1826: ABC transporter-related protein
 
Leptothrix cholodnii SP-6

Gene: Lcho_3558: ABC transporter-related protein
ABC transporter-related protein
COG4591
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2811: Predicted ABC transport system, permease protein
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_1147: Predicted ABC transport system, permease protein
 
Polaromonas sp. JS666

Gene: Bpro_1679: Predicted ABC transport system, permease protein
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_1563: Predicted ABC transport system, permease protein
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_3394: Predicted ABC transport system, permease protein
 
Methylibium petroleiphilum PM1

Gene: Mpe_A1825: Predicted ABC transport system, permease protein
 
Leptothrix cholodnii SP-6

Gene: Lcho_3557: Predicted ABC transport system, permease protein
Predicted ABC transport system, permease protein
Aave_2810
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2810: Conserved hypothetical protein
 
Acidovorax sp. JS42

Gene: Ajs_2031: Conserved hypothetical protein
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1

Gene: Daci_3950: Conserved hypothetical protein
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_1148: Conserved hypothetical protein
 
Polaromonas sp. JS666

Gene: Bpro_1680: Conserved hypothetical protein
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Conserved hypothetical protein
PF11736
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2809: Lipoprotein, putative
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_1149: Lipoprotein, putative
 
Polaromonas sp. JS666

Gene: Bpro_1681: Lipoprotein, putative
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_1562: Lipoprotein, putative
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_3393: Lipoprotein, putative
 
Methylibium petroleiphilum PM1

Gene: Mpe_A1829: Lipoprotein, putative
 
Leptothrix cholodnii SP-6

Gene: Lcho_3556: Lipoprotein, putative
Lipoprotein, putative
COG4531
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2808: Predicted zinc-binding periplasmic protein
 
Acidovorax sp. JS42

Gene: Ajs_2032: Predicted zinc-binding periplasmic protein
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_1826: Predicted zinc-binding periplasmic protein
 
Delftia acidovorans SPH-1

Gene: Daci_3949: Predicted zinc-binding periplasmic protein
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666

Gene: Bpro_1682: Predicted zinc-binding periplasmic protein
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_3718: Predicted zinc-binding periplasmic protein
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1

Gene: Mpe_A2933: Predicted zinc-binding periplasmic protein
 
Leptothrix cholodnii SP-6
Predicted zinc-binding periplasmic protein
omr
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2807: Predicted zinc-regulated TonB-dependent outer membrane transporter
 
Acidovorax sp. JS42

Gene: Ajs_2033: Predicted zinc-regulated TonB-dependent outer membrane transporter
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_1825: Predicted zinc-regulated TonB-dependent outer membrane transporter
 
Delftia acidovorans SPH-1

Gene: Daci_3948: Predicted zinc-regulated TonB-dependent outer membrane transporter
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666

Gene: Bpro_1683: Predicted zinc-regulated TonB-dependent outer membrane transporter
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_3717: Predicted zinc-regulated TonB-dependent outer membrane transporter
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1

Gene: Mpe_A2932: Predicted zinc-regulated TonB-dependent outer membrane transporter
 
Leptothrix cholodnii SP-6
Predicted zinc-regulated TonB-dependent outer membrane transporter
 
CRON 2.
znuC
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
*
Polaromonas naphthalenivorans CJ2

Site:
position = -251
score = 6.54155
sequence = TTAATGCAATTCAGTTGCGTTAC

Site:
position = -219
score = 6.12467
sequence = CTATCGCAATCAGGTTGCATTAT

Gene: Pnap_1144: Zinc ABC transporter, ATP-binding protein ZnuC
 
Polaromonas sp. JS666
*
Rhodoferax ferrireducens DSM 15236

Site:
position = -251
score = 6.62261
sequence = ATATCGCAATTCAGTTGCATTAT

Site:
position = -277
score = 6.38423
sequence = TTATTGCAATTGAGTTGCGTTAA

Gene: Rfer_2053: Zinc ABC transporter, ATP-binding protein ZnuC
 
Variovorax paradoxus S110

Gene: Vapar_2782: Zinc ABC transporter, ATP-binding protein ZnuC
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_3390: Zinc ABC transporter, ATP-binding protein ZnuC
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6

Gene: Lcho_3562: Zinc ABC transporter, ATP-binding protein ZnuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_1143: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_2052: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Variovorax paradoxus S110

Gene: Vapar_2783: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_3391: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6

Gene: Lcho_3561: Zinc ABC transporter, inner membrane permease protein ZnuB
Zinc ABC transporter, inner membrane permease protein ZnuB
znuA
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_1142: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_2051: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Variovorax paradoxus S110

Gene: Vapar_2784: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_3392: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6

Gene: Lcho_3560: Zinc ABC transporter, periplasmic-binding protein ZnuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD