Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Zur - Burkholderia

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 22 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Burkholderia pseudomallei K96243 9 3
Burkholderia mallei ATCC 23344 7 3
Burkholderia sp. 383 14 4
Burkholderia cepacia AMMD 5 2
Burkholderia vietnamiensis G4 5 2
Burkholderia glumae BGR1 5 2
Burkholderia xenovorans LB400 8 2
Burkholderia phymatum STM815 4 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
yciC
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
*
Burkholderia sp. 383

Site:
position = -8
score = 6.0552
sequence = GAAATGATATGTTATATCGTTGC

Gene: Bcep18194_B0316: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
folE2
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383

Gene: Bcep18194_B0317: GTP cyclohydrolase I (EC 3.5.4.16) type 2
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815
GTP cyclohydrolase I (EC 3.5.4.16) type 2
queD2
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383

Gene: Bcep18194_B0318: 6-pyruvoyl-tetrahydropterin synthase-like
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815
6-pyruvoyl-tetrahydropterin synthase-like
can2
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383

Gene: Bcep18194_B0319: Carbonic anhydrase
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815
Carbonic anhydrase
pyrC2
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383

Gene: Bcep18194_B0320: Dihydroorotase (EC 3.5.2.3)
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815
Dihydroorotase (EC 3.5.2.3)
 
CRON 2.
omr2
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
*
Burkholderia xenovorans LB400

Site:
position = -165
score = 4.93616
sequence = TGAATGTAATGATATAACATTCC

Gene: Bxe_B0900: Predicted zinc-related TonB-dependent outer membrane transporter
 
Burkholderia phymatum STM815
Predicted zinc-related TonB-dependent outer membrane transporter
exbB
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400

Gene: Bxe_B0899: Biopolymer transport protein, MotA/TolQ/ExbB proton channel family protein
 
Burkholderia phymatum STM815
Biopolymer transport protein, MotA/TolQ/ExbB proton channel family protein
exbD
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400

Gene: Bxe_B0898: Biopolymer transport protein ExbD/TolR
 
Burkholderia phymatum STM815
Biopolymer transport protein ExbD/TolR
tonB
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400

Gene: Bxe_B0897: Biopolymer transport protein, TonB protein
 
Burkholderia phymatum STM815
Biopolymer transport protein, TonB protein
 
CRON 3.
omr1
*
Burkholderia pseudomallei K96243

Site:
position = -303
score = 5.84261
sequence = CGGATGATATGTTATATCATCGT

Gene: BPSL2724: Predicted zinc-related TonB-dependent outer membrane transporter
*
Burkholderia mallei ATCC 23344

Site:
position = -301
score = 5.84261
sequence = CGGATGATATGTTATATCATCGT

Gene: BMA2036: Predicted zinc-related TonB-dependent outer membrane transporter
*
Burkholderia sp. 383

Site:
position = -209
score = 5.31911
sequence = GAATTGATATTTTGTATCATCTG

Gene: Bcep18194_A4489: Predicted zinc-related TonB-dependent outer membrane transporter
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1

Gene: bglu_2g14800: Predicted zinc-related TonB-dependent outer membrane transporter
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815
Predicted zinc-related TonB-dependent outer membrane transporter
fecE
 
Burkholderia pseudomallei K96243

Gene: BPSL2723: Iron-siderophore ABC transport system, ATP-binding protein
 
Burkholderia mallei ATCC 23344

Gene: BMA2035: Iron-siderophore ABC transport system, ATP-binding protein
 
Burkholderia sp. 383

Gene: Bcep18194_A4490: Iron-siderophore ABC transport system, ATP-binding protein
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1

Gene: bglu_2g14790: Iron-siderophore ABC transport system, ATP-binding protein
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815
Iron-siderophore ABC transport system, ATP-binding protein
fecC
 
Burkholderia pseudomallei K96243

Gene: BPSL2722: Iron-siderophore ABC transport system, substrate-binding protein
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383

Gene: Bcep18194_A4491: Iron-siderophore ABC transport system, substrate-binding protein
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1

Gene: bglu_2g14780: Iron-siderophore ABC transport system, substrate-binding protein
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815
Iron-siderophore ABC transport system, substrate-binding protein
fecD
 
Burkholderia pseudomallei K96243

Gene: BPSL2721: Iron-siderophore ABC transport system, permease protein
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383

Gene: Bcep18194_A4492: Iron-siderophore ABC transport system, permease protein
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1

Gene: bglu_2g14770: Iron-siderophore ABC transport system, permease protein
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815
Iron-siderophore ABC transport system, permease protein
 
CRON 4.
zur
*
Burkholderia pseudomallei K96243

Site:
position = -51
score = 6.00912
sequence = GCGCGGATACGTTATATCATCAC

Gene: BPSL0825: Zinc uptake regulation protein Zur
*
Burkholderia mallei ATCC 23344

Site:
position = 9
score = 6.00912
sequence = GCGCGGATACGTTATATCATCAC

Gene: BMA0329: Zinc uptake regulation protein Zur
*
Burkholderia sp. 383

Site:
position = -53
score = 6.12717
sequence = ACGGCGATACGTTATATCATCGC

Gene: Bcep18194_A5930: Zinc uptake regulation protein Zur
*
Burkholderia cepacia AMMD

Site:
position = -54
score = 6.29513
sequence = AGGGAGATACGTTATATCATCGC

Gene: Bamb_2647: Zinc uptake regulation protein Zur
*
Burkholderia vietnamiensis G4

Site:
position = -53
score = 6.32398
sequence = GGCGAGATACGTTATATCATCGC

Gene: Bcep1808_2713: Zinc uptake regulation protein Zur
*
Burkholderia glumae BGR1

Site:
position = -53
score = 5.54648
sequence = GGCTGGATACGTTATATCATCCG

Gene: bglu_1g29530: Zinc uptake regulation protein Zur
*
Burkholderia xenovorans LB400

Site:
position = -84
score = 6.18522
sequence = ATCGAGATACGTTATATCATTGC

Gene: Bxe_A0718: Zinc uptake regulation protein Zur
*
Burkholderia phymatum STM815

Site:
position = -59
score = 6.02402
sequence = TTCGAGATACGTTATATCATTGC

Gene: Bphy_0488: Zinc uptake regulation protein Zur
Zinc uptake regulation protein Zur
znuA
 
Burkholderia pseudomallei K96243

Gene: BPSL0824: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Burkholderia mallei ATCC 23344

Gene: BMA0328: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Burkholderia sp. 383

Gene: Bcep18194_A5931: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Burkholderia cepacia AMMD

Gene: Bamb_2648: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_2714: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Burkholderia glumae BGR1

Gene: bglu_1g29540: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Burkholderia xenovorans LB400

Gene: Bxe_A0717: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Burkholderia phymatum STM815

Gene: Bphy_0487: Zinc ABC transporter, periplasmic-binding protein ZnuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
znuC
 
Burkholderia pseudomallei K96243

Gene: BPSL0823: Zinc ABC transporter, ATP-binding protein ZnuC
 
Burkholderia mallei ATCC 23344

Gene: BMA0327: Zinc ABC transporter, ATP-binding protein ZnuC
 
Burkholderia sp. 383

Gene: Bcep18194_A5932: Zinc ABC transporter, ATP-binding protein ZnuC
 
Burkholderia cepacia AMMD

Gene: Bamb_2649: Zinc ABC transporter, ATP-binding protein ZnuC
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_2715: Zinc ABC transporter, ATP-binding protein ZnuC
 
Burkholderia glumae BGR1

Gene: bglu_1g29550: Zinc ABC transporter, ATP-binding protein ZnuC
 
Burkholderia xenovorans LB400

Gene: Bxe_A0716: Zinc ABC transporter, ATP-binding protein ZnuC
 
Burkholderia phymatum STM815

Gene: Bphy_0486: Zinc ABC transporter, ATP-binding protein ZnuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
 
Burkholderia pseudomallei K96243

Gene: BPSL0822: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Burkholderia mallei ATCC 23344

Gene: BMA0326: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Burkholderia sp. 383

Gene: Bcep18194_A5933: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Burkholderia cepacia AMMD

Gene: Bamb_2650: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_2716: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Burkholderia glumae BGR1

Gene: bglu_1g29560: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Burkholderia xenovorans LB400

Gene: Bxe_A0715: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Burkholderia phymatum STM815

Gene: Bphy_0485: Zinc ABC transporter, inner membrane permease protein ZnuB
Zinc ABC transporter, inner membrane permease protein ZnuB
 
CRON 5.
omr
*
Burkholderia pseudomallei K96243

Site:
position = -87
score = 6.08335
sequence = ATATTGATACGTTATATCGTTTC

Site:
position = -199
score = 4.79213
sequence = GAAATGATATAACATATCGATAC

Gene: BPSS1850: Predicted zinc-related TonB-dependent outer membrane transporter
*
Burkholderia mallei ATCC 23344

Site:
position = -87
score = 6.08335
sequence = ATATTGATACGTTATATCGTTTC

Site:
position = -199
score = 4.79213
sequence = GAAATGATATAACATATCGATAC

Gene: BMAA0251: Predicted zinc-related TonB-dependent outer membrane transporter
*
Burkholderia sp. 383

Site:
position = -182
score = 5.70093
sequence = GAAATGATATAACATATCATTTC

Gene: Bcep18194_B1524: Predicted zinc-related TonB-dependent outer membrane transporter
*
Burkholderia cepacia AMMD

Site:
position = -217
score = 5.75624
sequence = GAGATGATATAACATATCATTTC

Gene: Bamb_3871: Predicted zinc-related TonB-dependent outer membrane transporter
*
Burkholderia vietnamiensis G4

Site:
position = -179
score = 4.92682
sequence = GAAATGATATAACGTATCATCTT

Site:
position = -74
score = 5.09241
sequence = ACGATGCAACAATATATCGTTTC

Gene: Bcep1808_4992: Predicted zinc-related TonB-dependent outer membrane transporter
*
Burkholderia glumae BGR1

Site:
position = -197
score = 5.92076
sequence = AAAATGATACGTTATATCGTGTC

Gene: bglu_2g16600: Predicted zinc-related TonB-dependent outer membrane transporter
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815
Predicted zinc-related TonB-dependent outer membrane transporter
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD